Search

BR-112022019284-B1 - Polynucleotide cassette, nucleic acid sequence, riboswitch for regulation of target gene expression, and vector.

BR112022019284B1BR 112022019284 B1BR112022019284 B1BR 112022019284B1BR-112022019284-B1

Abstract

APTAMERS THAT BIND TO THIAMINE ANALOGUES AND DERIVATIVES. This disclosure relates to oligonucleotide aptamers that bind to certain small molecules, including thiamine analogues and derivatives, and methods for generating aptamers that bind to small molecules. Riboswitches and polynucleotide cassettes comprising the aptamers disclosed herein are also contemplated. Methods for using said aptamers, riboswitches and/or polynucleotides for the regulation of target genes, including therapeutic genes, are further provided. Small molecules that are modulators of target gene expression, where the target gene contains a riboswitch comprising an aptamer described herein, are also provided herein.

Inventors

  • Xuecui Guo
  • Alexandria Forbes
  • KEVIN G. LIU
  • Ji-In Kim

Assignees

  • MeiraGTx Gene Regulation Limited

Dates

Publication Date
20260317
Application Date
20210324
Priority Date
20200324

Claims (20)

  1. 1. Polynucleotide cassette for regulating the expression of a target gene characterized in that the polynucleotide cassette comprises an aptamer coding sequence that binds to a small molecule, wherein the aptamer coding sequence comprises a sequence selected from the group consisting of SEQ ID NOs: 8-36.
  2. 2. Polynucleotide cassette, according to claim 1, characterized in that the aptamer coding sequence is selected from the group consisting of SEQ IDs NOs: 8, 9, 14-18, 21, 25, 26 and 30.
  3. 3. Polynucleotide cassette, according to claim 1, characterized in that the aptamer coding sequence comprises a sequence selected from the group consisting of SEQ IDs 9, 14 and 26.
  4. 4. Nucleic acid sequence encoding an aptamer that binds to a small molecule characterized in that the aptamer coding sequence comprises ACX1GGGGTCCGGCX2TX3TTCATTTGGCX4CCGGTGAGAX5X6AX7ACCC TTX8X9X10X11CCTGTTX12ACGGATAATGCCGCX13GCAGGGAGT (SEQ ID NO:1) and wherein: X1 is A or G; X2 is C or no nucleotide; X3 is T or no nucleotide; X4 is A or G; X5 is any nucleotide; X6 is any nucleotide; X7 is any nucleotide; X8 is any nucleotide; X9 is C, G or T; X10 is any nucleotide; X11 is A or T; X12 is C; and X13 is T.
  5. 5. Nucleic acid sequence according to claim 4, characterized in that the aptamer coding sequence comprises ACX1GGGGTCCGGCX2TX3TTCATTTGGCGCCGGTGAGAX5X6AX7ACCC TTX8X9X10X11CCTGTTX12ACGGATAATGCCGCX13GCAGGGAGT (SEQ ID NO:2) wherein: X1 is A or G; X2 is C or no nucleotide; X3 is T or no nucleotide; X5 is G or T; X6 is C or T; X7 is C or T; X8 is any nucleotide; X9 is G or T; X10 is A, G or T; X11 is A or T; X12 is C; and X13 is T.
  6. 6. Nucleic acid sequence according to claim 4, characterized in that the aptamer coding sequence comprises ACAGGGGTCCGGCCTTTTCATTTGGCX4CCGGTGAGAX5X6AX7ACCCTT X8 X9X10ACCTGTTCACGGATAATGCCGCTGCAGGGAGT (SEQ ID NO:6) wherein: X4 is A or G; X5 is any nucleotide; X6 is any nucleotide; X7 is any nucleotide; X8 is any nucleotide; X9 is C or G; and X10 is any nucleotide.
  7. 7. Nucleic acid sequence according to claim 4, characterized in that the aptamer coding sequence comprises a sequence selected from the group consisting of SEQ ID Nos: 9 and 19-36.
  8. 8. Nucleic acid sequence according to claim 7, characterized in that the aptamer coding sequence is selected from the group consisting of SEQ ID NOs: 9, 21, 25, 26 and 30.
  9. 9. Nucleic acid sequence according to claim 8, characterized in that the aptamer coding sequence comprises a sequence selected from the group consisting of SEQ ID Nos: 9 and 26.
  10. 10. Polynucleotide cassette, according to any one of claims 1 to 3, characterized in that the aptamer binds to or responds to the presence of a small molecule having the structure as defined in any of: a) Formula I: wherein: R1 is selected from the group consisting of OH, amino, F, Cl, Br, phosphate, pyrophosphate, -OC(=O)-C1-C6 alkyl, -OC(=O)-C2-C6 alkenyl, -OC(=O)-phenyl, -OC(=O)-heterocycle, -OC(=O)-O-C1-C6 alkyl, -OC(=O)-O-C2-C6 alkenyl, -OC(=O)-O-phenyl and -OC(=O)-O-heterocycle; b) Formula II: wherein: R2 is selected from the group consisting of H, C1-C6 alkyl, C2-C6 alkenyl, -(CH2)n-R6, -C(=O)-R4, -C(=O)-O-R4, -CHR5-OC(=O)-R4, -S-C1-C6 alkyl, -S-C2-C6 alkenyl, -S-heterocycle and -S-CH2-heterocycle; or R2 is -S-[Formula II] such that the compound forms a dimer of two Formula II molecules linked through a disulfide bond (-SS-); R3 is selected from the group consisting of OH, amino, F, Cl, Br, phosphate, pyrophosphate, -OC(=O)-C1-C6 alkyl, -OC(=O)-C1-C6 alkenyl, -OC(=O)-phenyl, -OC(=O)-heterocycle, -OC(=O)-O-C1-C6 alkyl, -OC(=O)-O-C1-C6 alkenyl, -OC(=O)-O-phenyl, -OC(=O)-O-heterocycle; R4 is selected from the group consisting of H, C1-C6 alkyl, C2-C6 alkenyl, C3-C7 cycloalkyl, C6-C10 bicyclyl, C9-C14 tricyclyl, -(C1-C6 alkyl)-aryl, -(C2-C6 alkenyl)-aryl, aryl, heteroaryl and heterocyclyl; R5 is selected from the group consisting of H, C1-C6 alkyl, C2-C6 alkenyl, C3-C7 cycloalkyl, aryl, heteroaryl and heterocyclyl; R6 is hydroxyl, amino, amido, C1-C6 alkoxy, C3-C7 cycloalkyl, C6-C10 bicyclyl, aryl, heteroaryl and heterocyclyl; en is 1 to 8; and wherein each of alkyl, alkenyl, cycloalkyl, bicyclyl, tricyclyl, aryl, heteroaryl and heterocyclyl may be unsubstituted or substituted by 1 to 3 substituents selected from the group consisting of halogen, hydroxyl, amino, cyano, amido, sulfonamide, nitro, -SH, C1-C6 alkyl, C2-C6 alkenyl, C3-C7 cycloalkyl, C6-C10 bicyclyl, C1-C6 haloalkyl, C1-C6 per-haloalkyl, -O-(C1-C6 alkyl), O-(C3-C7 cycloalkyl), -O-(C1-C6 haloalkyl), -O-(C1-C6 per-haloalkyl), aryl, -O-aryl, -(C1-C6 alkyl)-aryl, -O-(C1-C6 alkyl)-aryl, -S-(C1-C6 alkyl), -S-(C3-C7 cycloalkyl), -S-(C1-C6 haloalkyl), -S-(C1-C6 perhaloalkyl), -S-aryl, -S-(C1-C6 alkyl)-aryl, heteroaryl and heterocyclyl; c) Formula III: wherein: R2 is selected from the group consisting of H, C1-C6 alkyl, C2-C6 alkenyl, -(CH2)n-R6, -C(=O)-R4, -C(=O)-O-R4, -CHR5-OC(=O)-R4, -S-C1-C6 alkyl, -S-C2-C6 alkenyl, -S-heterocycle and -S-CH2-heterocycle; R31 is selected from the group consisting of OH and phosphate; R4 is selected from the group consisting of H, C1-C6 alkyl, C2-C6 alkenyl, C3-C7 cycloalkyl, C6-C10 bicyclyl, C9-C14 tricyclyl, -(C1-C6 alkyl)-aryl, -(C2-C6 alkenyl)-aryl, aryl, heteroaryl and heterocyclyl; R5 is selected from the group consisting of H,C1-C6 alkyl, C2-C6 alkenyl, C3-C7 cycloalkyl, aryl, heteroaryl and heterocyclyl; R6 is hydroxyl, amino, amido, C1-C6 alkoxy, C3-C7 cycloalkyl, C6-C10 bicyclyl, aryl, heteroaryl and heterocyclyl; en is 1 to 8; and wherein each of alkyl, alkenyl, cycloalkyl, bicyclyl, tricyclyl, aryl, heteroaryl and heterocyclyl may be unsubstituted or substituted by 1 to 3 substituents selected from the group consisting of halogen, hydroxyl, amino, cyano, amido, sulfonamide, nitro, -SH, C1-C6 alkyl, C2-C6 alkenyl, C3-C7 cycloalkyl, C6-C10 bicyclyl, C1-C6 haloalkyl, C1-C6 per-haloalkyl, -O-(C1-C6 alkyl), O-(C3-C7 cycloalkyl), -O-(C1-C6 haloalkyl), -O-(C1-C6 per-haloalkyl), aryl, -O-aryl, -(C1-C6 alkyl)-aryl, -O-(C1-C6 alkyl)-aryl, -S-(C1-C6 alkyl), -S-(C3-C7 cycloalkyl), -S-(C1-C6 haloalkyl), -S-(C1-C6 perhaloalkyl), -S-aryl, -S-(C1-C6 alkyl)-aryl, heteroaryl and heterocyclyl; d) Formula IV: wherein: R4 is selected from the group consisting of H, C1-C6 alkyl, C2-C6 alkenyl, C3-C7 cycloalkyl, C6-C10 bicyclyl, C9-C14 tricyclyl, -(C1-C6 alkyl)-aryl, -(C2-C6 alkenyl)-aryl, aryl, heteroaryl and heterocyclyl; R5 is selected from the group consisting of H, C1-C6 alkyl, C2-C6 alkenyl, C3-C7 cycloalkyl, aryl, heteroaryl and heterocyclyl; and wherein each of alkyl, alkenyl, cycloalkyl, bicyclyl, tricyclyl, aryl, heteroaryl and heterocyclyl may be unsubstituted or substituted by 1 to 3 substituents selected from the group consisting of halogen, hydroxyl, amino, cyano, amido, sulfonamide, nitro, -SH, C1-C6 alkyl, C2-C6 alkenyl, C3-C7 cycloalkyl, C6-C10 bicyclyl, C1-C6 haloalkyl, C1-C6 per-haloalkyl, -O-(C1-C6 alkyl), O-(C3-C7 cycloalkyl), -O-(C1-C6 haloalkyl), -O-(C1-C6 per-haloalkyl), aryl, -O-aryl, -(C1-C6 alkyl)-aryl, -O-(C1-C6 alkyl)-aryl, -S-(C1-C6 alkyl), -S-(C3-C7 cycloalkyl), -S-(C1-C6 haloalkyl), -S-(C1-C6 perhaloalkyl), -S-aryl, -S-(C1-C6 alkyl)-aryl, heteroaryl and heterocyclyl; e) Formula V: wherein: R4 is selected from the group consisting of H, C1-C6 alkyl, C2-C6 alkenyl, C3-C7 cycloalkyl, C6-C10 bicyclyl, C9-C14 tricyclyl, -(C1-C6 alkyl)-aryl, -(C2-C6 alkenyl)-aryl, aryl, heteroaryl and heterocyclyl; and wherein each of alkyl, alkenyl, cycloalkyl, bicyclyl, tricyclyl, aryl, heteroaryl and heterocyclyl may be unsubstituted or substituted by 1 to 3 substituents selected from the group consisting of halogen, hydroxyl, amino, cyano, amido, sulfonamide, nitro, -SH, C1-C6 alkyl, C2-C6 alkenyl, C3-C7 cycloalkyl, C6-C10 bicyclyl, C1-C6 haloalkyl, C1-C6 per-haloalkyl, -O-(C1-C6 alkyl), O-(C3-C7 cycloalkyl), -O-(C1-C6 haloalkyl), -O-(C1-C6 per-haloalkyl), aryl, -O-aryl, -(C1-C6 alkyl)-aryl, -O-(C1-C6 alkyl)-aryl, -S-(C1-C6 alkyl), -S-(C3-C7 cycloalkyl), -S-(C1-C6 haloalkyl), -S-(C1-C6 perhaloalkyl), -S-aryl, -S-(C1-C6 alkyl)-aryl, heteroaryl and heterocyclyl; f) Formula VI: wherein: R4 is selected from the group consisting of H, C1-C6 alkyl, C2-C6 alkenyl, C3-C7 cycloalkyl, C6-C10 bicyclyl, C9-C14 tricyclyl, -(C1-C6 alkyl)-aryl, -(C2-C6 alkenyl)-aryl, aryl, heteroaryl and heterocyclyl; and wherein each of alkyl, alkenyl, cycloalkyl, bicyclyl, tricyclyl, aryl, heteroaryl and heterocyclyl may be unsubstituted or substituted by 1 to 3 substituents selected from the group consisting of halogen, hydroxyl, amino, cyano, amido, sulfonamide, nitro, -SH, C1-C6 alkyl, C2-C6 alkenyl, C3-C7 cycloalkyl, C6-C10 bicyclyl, C1-C6 haloalkyl, C1-C6 per-haloalkyl, -O-(C1-C6 alkyl), O-(C3-C7 cycloalkyl), -O-(C1-C6 haloalkyl), -O-(C1-C6 per-haloalkyl), aryl, -O-aryl, -(C1-C6 alkyl)-aryl, -O-(C1-C6 alkyl)-aryl, -S-(C1-C6 alkyl), -S-(C3-C7 cycloalkyl), -S-(C1-C6 haloalkyl), -S-(C1-C6 perhaloalkyl), -S-aryl, -S-(C1-C6 alkyl)-aryl, heteroaryl and heterocyclyl; g) Formula VII wherein: each R7 is independently selected from halogen, hydroxyl, amino, cyano, amido, sulfonamide, nitro, -SH, C1-C6 alkyl, C2-C6 alkenyl, C3-C7 cycloalkyl, C6-C10 bicyclyl, C1-C6 haloalkyl, C1-C6 per-haloalkyl, -O-(C1-C6 alkyl), O-(C3-C7 cycloalkyl), -O-(C1-C6 haloalkyl), -O-(C1-C6 per-haloalkyl), aryl, -O-aryl, -(C1-C6 alkyl)-aryl, -O-(C1-C6 alkyl)-aryl, -S-(C1-C6 alkyl), -S-(C3-C7 cycloalkyl), -S-(C1-C6 haloalkyl), -S-(C1-C6 per-haloalkyl), -S-aryl, -S-(C1-C6 alkyl)-aryl, heteroaryl and heterocyclyl; Alternatively, two adjacent R7 groups may be joined together to form a 5- or 6-membered aromatic or non-aromatic fused ring containing 0 to 2 heteroatoms in the ring and which is unsubstituted or substituted by up to four substituents selected from halogen, hydroxyl, amino, cyano, amido, sulfonamide, nitro, -SH, C1-C6 alkyl, C2-C6 alkenyl, C3-C7 cycloalkyl, C6-C10 bicyclyl, C1-C6 haloalkyl, C1-C6 per-haloalkyl, -O-(C1-C6 alkyl), O-(C3-C7 cycloalkyl), -O-(C1-C6 haloalkyl), -O-(C1-C6 per-haloalkyl), aryl, -O-aryl, -(C1-C6 alkyl)-aryl, -O-(C1-C6 alkyl)-aryl, -S-(C1-C6 alkyl), -S-(C3-C7 cycloalkyl), -S-(C1-C6 haloalkyl), -S-(C1-C6 perhaloalkyl), -S-aryl, -S-(C1-C6 alkyl)-aryl, heteroaryl and heterocyclyl; em is 0, 1, 2, 3 or 4; eh) Formula VIII wherein: each R8 is independently selected from halogen, hydroxyl, amino, cyano, amido, sulfonamide, nitro, -SH, C1-C6 alkyl, C2-C6 alkenyl, C3-C7 cycloalkyl, C6-C10 bicyclyl, C1-C6 haloalkyl, C1-C6 per-haloalkyl, -O-(C1-C6 alkyl), O-(C3-C7 cycloalkyl), -O-(C1-C6 haloalkyl), -O-(C1-C6 per-haloalkyl), aryl, -O-aryl, -(C1-C6 alkyl)-aryl, -O-(C1-C6 alkyl)-aryl, -S-(C1-C6 alkyl), -S-(C3-C7 cycloalkyl), -S-(C1-C6 haloalkyl), -S-(C1-C6 per-haloalkyl), -S-aryl, -S-(C1-C6 alkyl)-aryl, heteroaryl and heterocyclyl; Alternatively, two R8 groups may be joined together to form a 5- or 6-membered aromatic or non-aromatic fused ring containing 0 to 2 heteroatoms in the ring, and which is unsubstituted or substituted by up to four substituents selected from halogen, hydroxyl, amino, cyano, amido, sulfonamide, nitro, -SH, C1-C6 alkyl, C2-C6 alkenyl, C3-C7 cycloalkyl, C6-C10 bicyclyl, C1-C6 haloalkyl, C1-C6 per-haloalkyl, -O-(C1-C6 alkyl), O-(C3-C7 cycloalkyl), -O-(C1-C6 haloalkyl), -O-(C1-C6 per-haloalkyl), aryl, -O-aryl, -(C1-C6 alkyl)-aryl, -O-(C1-C6 alkyl)-aryl, -S-(C1-C6 alkyl), -S-(C3-C7 cycloalkyl), -S-(C1-C6 haloalkyl), -S-(C1-C6 perhaloalkyl), -S-aryl, -S-(C1-C6 alkyl)-aryl, heteroaryl and heterocyclyl; Each R9 is independently selected from halogen, hydroxyl, amino, cyano, amido, sulfonamide, nitro, -SH, C1-C6 alkyl, C2-C6 alkenyl, C3-C7 cycloalkyl, C6-C10 bicyclyl, C1-C6 haloalkyl, C1-C6 per-haloalkyl, -O-(C1-C6 alkyl), O-(C3-C7 cycloalkyl), -O-(C1-C6 haloalkyl), -O-(C1-C6 per-haloalkyl), aryl, -O-aryl, -(C1-C6 alkyl)-aryl, -O-(C1-C6 alkyl)-aryl, -S-(C1-C6 alkyl), -S-(C3-C7 cycloalkyl), -S-(C1-C6 haloalkyl), -S-(C1-C6 per-haloalkyl), -S-aryl, -S-(C1-C6 alkyl)-aryl, heteroaryl and heterocyclyl; Alternatively, two R9 groups may be joined together to form a 5- or 6-membered aromatic or non-aromatic fused ring containing 0 to 2 heteroatoms in the ring, and which is unsubstituted or substituted by up to four substituents selected from halogen, hydroxyl, amino, cyano, amido, sulfonamide, nitro, -SH, C1-C6 alkyl, C2-C6 alkenyl, C3-C7 cycloalkyl, C6-C10 bicyclyl, C1-C6 haloalkyl, C1-C6 per-haloalkyl, -O-(C1-C6 alkyl), O-(C3-C7 cycloalkyl), -O-(C1-C6 haloalkyl), -O-(C1-C6 per-haloalkyl), aryl, -O-aryl, -(C1-C6 alkyl)-aryl, -O-(C1-C6 alkyl)-aryl, -S-(C1-C6 alkyl), -S-(C3-C7 cycloalkyl), -S-(C1-C6 haloalkyl), -S-(C1-C6 per-haloalkyl), -S-aryl, -S-(C1-C6 alkyl)-aryl, heteroaryl and heterocyclyl; x is 0, 1, 2 or 3; ey is 0, 1, 2, 3 or 4.
  11. 11. Polynucleotide cassette, according to any one of claims 1 to 3, characterized in that the aptamer binds to, or otherwise responds to, the presence of a small molecule selected from the group consisting of acefurtiamine, acetiamine, alithiamine, amprolium, beclotiamine, benfotiamine, bentiamine, bisbentiamine, ketotiamine, cicotiamine, fursultiamine, monosphosphotiamine, octotiamine, oxythiamine, prosultiamine, sulbutiamine, thiamine, thiamine pyrophosphate and vintiamol.
  12. 12. Polynucleotide cassette, according to claim 11, characterized in that the aptamer binds to, or otherwise responds to, the presence of a small molecule selected from the group consisting of benfotiamine, fursultiamine, and prosultiamine.
  13. 13. Polynucleotide cassette, according to any one of claims 1 to 3, characterized in that the aptamer has reduced binding and/or shows a reduced response to thiamine pyrophosphate (TPP) compared with equimolar amounts of fursultiamine, benfotiamine or prosultiamine.
  14. 14. Polynucleotide cassette, according to claim 13, characterized in that the aptamer is in the context of a riboswitch encoded as part of a polynucleotide cassette to regulate the expression of a target gene.
  15. 15. Riboswitch for regulating target gene expression in response to a small molecule, wherein the riboswitch is characterized in that it comprises the aptamer as defined in any one of claims 1 to 14 and wherein the riboswitch comprises the sequence of SEQ ID NO: 37.
  16. 16. Polynucleotide cassette for regulating the expression of a target gene in response to a small molecule, wherein the polynucleotide cassette is characterized in that it comprises: (a) a riboswitch; and (b) an alternatively spliced exon flanked by a 5' intron and a 3' intron, wherein the riboswitch comprises (i) an effector region comprising a stem that includes the 5' splice site sequence of the 3' intron, and (ii) the polynucleotide cassette aptamer, as defined in any one of claims 1 to 3 or 10 to 14, or the nucleic acid sequence aptamer, as defined in any one of claims 4 to 9; and wherein the alternatively spliced exon comprises a stop codon that is in frame with the target gene when the alternatively spliced exon is in the target gene mRNA.
  17. 17. Polynucleotide cassette, according to claim 16, characterized in that the riboswitch comprises the sequence SEQ ID NO:37.
  18. 18. Polynucleotide cassette, according to claim 16, wherein the polynucleotide cassette is characterized in that it is located in the protein-coding sequence of the target gene.
  19. 19. Polynucleotide cassette, according to claim 16, wherein the polynucleotide cassette is characterized in that it is located in an untranslated region of the target gene or in an intron of the target gene.
  20. 20. Vector characterized in that it comprises the polynucleotide cassette, as defined in any one of claims 1 to 3, 10 to 14 or 16 to 19, nucleic acid, as defined in any one of claims 4 to 9, or riboswitch, as defined in claim 15.

Description

CROSS-REFERENCE TO RELATED REQUESTS [001] This application claims priority over U.S. Provisional Application No. 62/994,135, filed March 24, 2020, which is incorporated in its entirety by reference herein. FIELD [002] The present disclosure relates to oligonucleotide aptamers that bind to certain small molecules and methods for generating aptamers that bind to small molecules. Also contemplated are riboswitches and polynucleotide cassettes for regulating the expression of a target gene, wherein the polynucleotide cassettes comprise the aptamers disclosed in the present invention. Additionally, small molecules are provided that are modulators of the expression of the target gene wherein the target gene contains a riboswitch comprising an aptamer described in the present invention. FUNDAMENTALS [003] Aptamers are oligonucleotides that bind to a target ligand with high affinity and specificity. These nucleic acid sequences have proven to be of high therapeutic and diagnostic value with the recent FDA approval of the first aptamer drug and others in clinical pipelines. Their high degree of specificity and versatility have established RNA aptamers as one of the fundamental tools in the emerging field of RNA nanotechnology in the fight against human diseases, including cancer, viral infections, and other illnesses. [004] Furthermore, aptamers can be used as part of a riboswitch that has certain effects in the presence or absence of an aptamer ligand. For example, riboswitches can be used to regulate gene expression in response to the presence or absence of the aptamer ligand. [005] However, aptamers derived from prokaryotic sources or generated using in vitro selection methods often fail to demonstrate the functionality required for the expression of therapeutic target genes in eukaryotic systems. As such, new aptamer sequences are needed that have the ability to regulate gene expression in response to the presence or absence of a small molecule ligand. SUMMARY [006] The present invention provides aptamer sequences that bind to small molecules such as thiamine pyrophosphate (TPP) and analogs or derivatives thereof. Riboswitches and polynucleotide cassettes for regulating the expression of a target gene are also contemplated, wherein the polynucleotide cassettes comprise the aptamers disclosed in the present invention. In addition, methods for using said aptamers, riboswitches and/or polynucleotide cassettes for the regulation of target genes, including therapeutic genes, are provided. Also provided in the present invention are small molecules that are modulators of target gene expression wherein the target gene contains a riboswitch comprising an aptamer described in the present invention. [007] In one aspect, a polynucleotide cassette is provided for regulating the expression of a target gene, wherein the polynucleotide cassette comprises a sequence encoding an aptamer that binds to a small molecule, wherein the aptamer coding sequence comprises: ACX1GGGGTCCGGCX2TX3TTCATTTGGCX4CCGGTGAGAX5X6AX7ACCC TTX8X9X10X11CCTGTTX12ACGGATAATGCCGCX13GCAGGGAGT (SEQ ID NO:1), wherein X1 is A or G; X2 is C or no nucleotide; X3 is T or no nucleotide; X4 is A or G; X5 is any nucleotide; X6 is any nucleotide; X7 is any nucleotide; X8 is any nucleotide; X9 is C, G or T; X10 is any nucleotide; X11 is A or T; X12 is either C or T; and X13 is either C or T. [008] In one aspect, a polynucleotide cassette is provided for regulating the expression of a target gene, wherein the polynucleotide cassette comprises a sequence encoding an aptamer that binds to a small molecule, wherein the aptamer coding sequence comprises ACX1GGGGTCCGGCX2TX3TTCATTTGGCGCCGGTGAGAX5X6AX7ACCC TTX8X9X10X11CCTGTTX12ACGGATAATGCCGCX13GCAGGGAGT (SEQ ID NO:2), wherein X1 is A or G; X2 is C or no nucleotide; X3 is T or no nucleotide; X5 is G or T; X6 is C or T; X7 is C or T; X8 is any nucleotide; X9 is G or T; X10 is A, G or T; X11 is A or T; X12 is C or T; and X13 is C or T. [009] In one aspect, a polynucleotide cassette is provided for regulating the expression of a target gene, wherein the polynucleotide cassette comprises a sequence encoding an aptamer that binds to a small molecule, wherein the aptamer coding sequence comprises ACAGGGGTCCGGCCTTTTCATTTGGCGCCGGTGAGAGCACACCCTTT GAACCTGTTX12ACGGATAATGCCGCX13GCAGGGAGT (SEQ ID NO:3), wherein X12 is C or T; and X13 is C or T. [010] In one aspect, a polynucleotide cassette is provided for regulating the expression of a target gene, wherein the polynucleotide cassette comprises a sequence encoding an aptamer that binds to a small molecule, wherein the aptamer coding sequence comprises ACX1GGGGTCCGGCCTTTTCATTTGGCGCCGGTGAGAGCACACCCTTX 8X9X10X11CCTGTTTACGGATAATGCCGCCCGCAGGGAGT (SEQ ID NO:4), wherein XIII is A or G; X8 is any nucleotide; X9 is G or T; X10 is A, G or T; and XIV is A or T. [011] In one aspect, a polynucleotide cassette is provided for regulating the expression of a target gene, wherein the polynucleotide cassette c