Search

CN-110079492-B - Escherichia coli M4 mutant strain, and preparation method and application thereof

CN110079492BCN 110079492 BCN110079492 BCN 110079492BCN-110079492-B

Abstract

The invention belongs to the field of biological engineering, and provides an Escherichia coli M4 mutant strain, and a preparation method and application thereof. Carrying out error-prone PCR on the pseudomonas aeruginosa foldase gene, cloning the mutated foldase gene and the pseudomonas aeruginosa lipase gene into pACYCDuet-1 recombinant plasmid, transferring the plasmid into E.coli BL21(DE3) for co-expression, and carrying out primary screening and secondary screening to obtain a mutant strain, wherein the specific activity of the intracellular lipase is 2.1 times that of the mutant strain. Compared with the un-mutant strain, one amino acid residue of the recombined foldase in the mutant strain is changed, and glycine is mutated into glutamic acid. The invention provides a new method for improving the lipase activity.

Inventors

  • PENG REN
  • TONG CHUNMEI
  • LIN MINGQING

Assignees

  • 江西师范大学
  • 江西师范大学

Dates

Publication Date
20220913
Application Date
20190516
Priority Date
20190516

Claims (1)

  1. 1. Escherichia coli Use of a mutant strain M4 for the production of lipase, characterized in that: the above-mentioned Escherichia coli The M4 mutant is preserved in China center for type culture Collection with the preservation date of 2019, 4 months and 10 days and the preservation number of CCTCC NO: M2019245.

Description

Escherichia coli M4 mutant strain, and preparation method and application thereof Technical Field The invention belongs to the field of biological engineering, and particularly relates to an Escherichia coli M4 (E.coli M4) mutant strain, and a preparation method and application thereof. Background Lipases are not only widely used in the traditional industries of industry, agriculture and animal husbandry, but also increasingly paid more attention in the fields of biosensors, biodiesel synthesis, diagnostic tool enzymes, etc. The lipase has wide sources, and can be extracted by culturing microorganisms or obtained from animals and plants. The microbial lipase has the characteristics of diverse catalytic activity, high yield, convenience in extraction, short microbial growth cycle, easiness in gene operation and the like, so that the microbial lipase is more widely applied compared with animal and plant derived lipases. Lipases from pseudomonas aeruginosa are the ones with a long history of research. It has high activity, stability and selectivity. However, lipases in P.aeruginosa are dependent on specific folding enzymes and need to be folded correctly into an active conformation with the aid of the folding enzymes. The lipase and the specific folding enzyme thereof have higher affinity. The studies prove that the three secondary bonds, namely hydrophobic interaction, hydrogen bond and salt bond, are mainly used for interaction to form an intermediate complex. Experiments prove that the lipase subjected to chemical denaturation treatment can realize renaturation with the help of the folding enzyme of the lipase. During the binding process with lipase, the secondary and tertiary structures of the folded enzyme are significantly changed. Some studies have shown that: the foldase assists the corresponding lipase to fold correctly, and cannot further assist the folding of another lipase, so that the foldase is a catalyst for single turnover. However, Northern blot experiments gave different results. This experiment shows that although the transcription of the foldase and lipase genes is synchronous and proportional, after their transcription is complete, a significant portion of the mRNA encoding the foldase protein is degraded, and therefore the number of foldase molecules produced is much smaller than that of lipase. This indicates that the foldase protein assists the corresponding lipase in folding correctly, and is separated from the lipase, and can continue to assist the folding of the next corresponding lipase molecule, and thus is a multi-turn catalyst (Chenkyki, etc., lipase specific foldase, Biotechnology report, 2011,4: 35-39). Disclosure of Invention The invention aims to provide an Escherichia coli M4 mutant strain, a preparation method and application thereof, and solves the problems in the prior art at least to a certain extent. The Escherichia coli M4 mutant strain provided by the invention is preserved in China center for type culture Collection (Wuhan university), the preservation date is 2019, 04 months and 10 days, and the preservation number is CCTCC NO: M2019245. The preparation method of the Escherichia coli M4 mutant strain comprises the following steps: (1) carrying out PCR amplification by taking a pet28a-lip plasmid carrying Pseudomonas aeruginosa CS-2 lipase gene as a template, carrying out double enzyme digestion on a PCR amplification product through BamHI and HindIII, and connecting a gene fragment obtained by double enzyme digestion with a plasmid pACYCDuet-1 to obtain a recombinant plasmid pACYCDuet-1-lip; (2) using pet28a-fold plasmid carrying Pseudomonas aeruginosa CS-2 foldase gene as a template, carrying out error-prone PCR amplification, carrying out double enzyme digestion on an error-prone PCR amplification product by NdeI and XhoI, and connecting a gene fragment obtained by double enzyme digestion with a recombinant plasmid pACYCDuet-1-lip to obtain a recombinant plasmid pACYCDuet-1-lip-fold; (3) the recombinant plasmid pACYCDuet-1-lip-fold is transformed into a competent cell E.coli BL21(DE3), inoculated into a screening culture medium for culture, and subjected to primary screening and secondary screening to obtain an Escherichia coli M4 mutant strain. In the step (1), the sequence of the forward primer for PCR amplification is CCTTGGATCCGATGAAGAAGAAGTCTCTGCTCC, the reverse primer sequence is CCTTAAGCTTCTACAGGCTGGCGTTCTTCAGG。 In the step (2), the sequence of the forward primer of error-prone PCR amplification is GGAATTCCATATGATGAAGAAAATCCTCCTGC, the reverse primer sequence is AATTCTCGAGGCGCTGCTCGGCCTG。 One amino acid residue of the recombinant foldase in the above Escherichia coli M4 mutant was changed from glycine (non-mutant) to glutamic acid (mutant) as compared with the non-mutant. Therefore, the specific activity of the lipase in the Escherichia coli M4 mutant strain is improved, and the specific activity of the lipase in the Escherichia coli M4 mutant strain is 2.1