Search

CN-115181811-B - Method for identifying traditional Chinese medicine radix ophiopogonis and liriope spicata based on MLPA technology

CN115181811BCN 115181811 BCN115181811 BCN 115181811BCN-115181811-B

Abstract

The invention discloses a method for identifying traditional Chinese medicine radix ophiopogonis and liriope spicata based on multiplex ligation probe amplification technology, which comprises the following steps of 1) extracting sample genome DNA, 2) amplifying chloroplast gene fragments of radix ophiopogonis and liriope spicata by using a specific primer and purifying amplified products by using the genome DNA as a template, 3) hybridizing an MLPA probe with the purified products, 4) ligating the hybridized products by using DNA ligase, 5) carrying out qPCR amplification on the ligature products by using a universal primer, and 6) collecting melting curve signals and observing Tm values. The method can identify the traditional Chinese medicinal materials ophiopogon root and liriope spicata simultaneously in a short time, has the advantages of strong specificity, high sensitivity and the like, and has good application prospect in the field of identification of the authenticity of the traditional Chinese medicinal materials.

Inventors

  • WANG BO
  • HU MIN
  • XU LING
  • WANG WENBIN
  • LI XIAOFANG
  • CHENG HUACHUN
  • MO JING

Assignees

  • 湖北省药品监督检验研究院

Dates

Publication Date
20260512
Application Date
20220621

Claims (4)

  1. 1. The method for identifying the traditional Chinese medicine radix ophiopogonis and liriope spicata based on the multiplex ligation probe amplification technology is characterized by comprising the following steps of: 1) Extracting genomic DNA of a sample; 2) Amplifying chloroplast gene fragments of radix ophiopogonis and radix ophiopogonis by using the extracted genome DNA as a template and purifying amplified products, wherein nucleotide sequences of the chloroplast gene fragments of the radix ophiopogonis and the radix ophiopogonis are respectively shown as SEQ ID NO. 8 and SEQ ID NO. 9; 3) Hybridizing the MLPA probe with the purified product; 4) Ligating the hybridization product of step 3) using a DNA ligase; 5) Performing qPCR amplification on the connection product of the step 4) by using a universal Primer, wherein the universal Primer has the sequence shown in SEQ ID NO. 6 as a Primer F, and the sequence shown in SEQ ID NO. 7 as a Primer R; 6) Collecting melting curve signals, observing Tm values, Wherein, MLPA probe is totally 3, by two left probes and a right probe composition, the probe sequence is as follows: The dwarf lilyturf tuber left probe has a sequence shown as SEQ ID NO. 1; the left probe of liriope spicata has a sequence shown as SEQ ID NO. 2; the common right probe has a sequence shown as SEQ ID NO. 3; In the MLPA probe, the volume ratio of the dwarf lilyturf tuber left probe to the common right probe is 0.6:1.0:1.6; In the step 6), the identification is carried out by observing the melting curve peak and the Tm value of the sample, if the sample shows a single melting curve peak and the Tm value is 78.98 ℃ plus or minus 0.1 ℃, the sample is dwarf lilyturf tuber, if the sample shows a single melting curve peak and the Tm value is 80.57 ℃ plus or minus 0.1 ℃, the sample is dwarf lilyturf tuber, and if the sample shows a double melting curve peak and the melting peak Tm value is 78.98 ℃ plus or minus 0.1 ℃ and 80.57 ℃ plus or minus 0.1 ℃, the sample is mixed by dwarf lilyturf tuber and dwarf lilyturf tuber.
  2. 2. The method for identifying Chinese medicinal materials ophiopogon root and liriope spicata according to claim 1, wherein the DNA ligase is 9 DEG N DNA LIGASE.
  3. 3. The method for identifying Chinese medicinal materials ophiopogon root and liriope spicata according to claim 1, wherein the hybridization temperature is 72 ℃.
  4. 4. The method for identifying Chinese medicinal materials ophiopogon root and liriope spicata according to claim 1, wherein the cycle number of qPCR amplification is 28.

Description

Method for identifying traditional Chinese medicine radix ophiopogonis and liriope spicata based on MLPA technology Technical Field The invention belongs to the field of Chinese herbal medicine identification, and particularly relates to a method for identifying Chinese herbal medicine radix ophiopogonis and liriope spicata based on a multiple connection probe amplification (multiplex ligation-DEPENDENT PROBE AMPLIFICATION, MLPA) technology. Background Radix Ophiopogonis and radix Ophiopogonis have been used as medicinal plants for thousands of years. The radix Ophiopogonis is a dry root tuber of radix Ophiopogonis Ophiopogon japonicus (L.f) Ker-Gawl of genus Ophiopogon of family Liliaceae, and has effects of nourishing yin, promoting salivation, moistening lung, and clearing heart fire. Can be used for treating cough due to lung dryness, cough due to consumption of yin, sore throat, thirst due to body fluid deficiency, internal heat, insomnia, and constipation due to intestinal dryness. The ophiopogon root is a traditional Chinese medicine which can be used for preventing and treating and is also used in the category of health-care food, and is one of the raw materials of both medicine and food and health-care food released by the ministry of health in China. At present, various lilyturf root mixed and counterfeited products exist on the market, and are mainly derived from plants of ophiopogon and ophiopogon Liriope, wherein the most common plants are ophiopogon root and ophiopogon latifolia. The radix Ophiopogonis is dry root tuber of radix Ophiopogonis of genus radix Ophiopogonis of family Liliaceae, such as Hubei radix Ophiopogonis Liriope spicata (thunder.) Lour. Var. Prolifera Y.T.Ma or Liriope muscari Liriope mus cari (Decne.) Baily. Both are recorded in Chinese pharmacopoeia (2020 edition), and the pharmacopoeia does not combine the two, and the two have the same nature and taste, similar characters, the same functions and indications, and are easy to be mixed for use. In the market, most commercial products do not strictly distinguish radix ophiopogonis from radix ophiopogonis, but take radix ophiopogonis as a substitute for radix ophiopogonis, and are uniformly called radix ophiopogonis, and the variety is not noted. Because the effects of the radix ophiopogonis and the radix ophiopogonis are not completely consistent and have different prices, the mixed use of the two can not only influence the efficacy, but also cause economic loss. Sequence alignment screening shows that 3 stable mutation sites exist between the ophiopogon and the ophiopogon in the chloroplast gene fragment sequence, namely A/G, A/T, C/T. Thus, these 3 different sites can be used as discrimination sites between two genera. Meanwhile, the gene fragment sequence can be used as an intergeneric identification marker of the ophiopogon and the ophiopogon. Based on the above, the invention combines the MLPA technology with the melting curve, designs a specific probe for the mutation site to amplify, obtains the melting temperature from the melting curve peak formed by the melting curve, identifies the dwarf lilyturf tuber and the dwarf lilyturf tuber according to the difference of Tm values, and carries out the experiments of specificity, sensitivity and adulteration ratio. The invention constructs a system for identifying the basic species of the dwarf lilyturf tuber medicinal material, establishes a rapid detection and identification method for the problem of mutual doping of dwarf lilyturf tuber and dwarf lilyturf tuber medicinal materials by using a molecular biological technology, and provides technical support for the original origin of the dwarf lilyturf tuber medicinal material and the safety of clinical medication. Disclosure of Invention The invention adopts an MLPA method to design probes aiming at chloroplast gene segment sequences of traditional Chinese medicinal materials of dwarf lilyturf tuber and dwarf lilyturf tuber, thereby establishing a method capable of identifying dwarf lilyturf tuber and dwarf lilyturf tuber medicinal materials simultaneously. A method for identifying traditional Chinese medicine radix ophiopogonis and liriope spicata based on multiplex ligation probe amplification technology comprises the following steps: 1) Extracting genomic DNA of a sample; 2) Amplifying chloroplast gene fragments of radix ophiopogonis and liriope spicata by using the extracted genome DNA as a template and utilizing a specific primer, and purifying amplified products; 3) Hybridizing the MLPA probe with the purified product; 4) Ligating the hybridization product of step 3) using a DNA ligase; 5) qPCR amplification of the ligation product of step 4) using universal primers; 6) Melting curve signals were collected and Tm values were observed. Wherein, MLPA probe is totally 3, by two left probes and a right probe composition, the probe sequence is as follows: Left dwarf lilyturf tuber probe GGGTTCCCTAAGGGTTGGACAAGTATTTAGTCTTTGT