CN-115612692-B - Transcription factor SrMYB for regulating stevioside synthesis, expression protein and application thereof
Abstract
The invention discloses a transcription factor SrMYB for regulating stevioside synthesis, an expression protein and application thereof, and belongs to the technical field of plant genetic engineering. The nucleotide sequence of the transcription factor SrMYB is shown as SEQ ID NO.1, and the amino acid sequence of the expressed protein is shown as SEQ ID NO. 2. Subcellular localization in tobacco epidermal cells shows that the protein encoded by the gene is mainly localized in cell nucleus, and the yeast activity experiment shows that the protein has transcription activation activity. Yeast single hybridization experiments show that SrMYB1 can be combined on the promoter of stevioside synthesis key gene SrUGT76G 1. Promoter activity and transgenic experiments all showed that SrMYB1 significantly inhibited the transcription of SrUGT76G 1. Based on the characteristics, a certain reference can be provided for stevioside quality control and new variety cultivation of stevia rebaudiana.
Inventors
- ZHANG TING
- YANG YONGHENG
- SUN YUMING
- XU XIAOYANG
- WANG YINJIE
- ZHANG YONGXIA
- YUAN HAIYAN
- LIU QINGQUAN
Assignees
- 江苏省中国科学院植物研究所
Dates
- Publication Date
- 20260508
- Application Date
- 20220512
Claims (5)
- 1. A stevia rebaudiana SrMYB gene has a nucleotide sequence shown in SEQ ID NO. 1.
- 2. The expressed protein of stevia rebaudiana SrMYB gene as set forth in claim 1, wherein the amino acid sequence of the expressed protein is shown in SEQ ID No. 2.
- 3. A primer pair for cloning and obtaining the stevia SrMYB gene according to claim 1, the primer pair having the sequence: SrMYB1-F:CTTAGCTTCCAGTCTGCCCC; SrMYB1-R:CCCTCTAGAAGGTTCACACCAG。
- 4. a vector or host bacterium comprising the stevia rebaudiana SrMYB gene of claim 1.
- 5. Use of the stevia rebaudiana SrMYB gene of claim 1 for regulating SrUGT G1 gene expression in steviol glycoside biosynthesis, wherein overexpression of said stevia SrMYB gene inhibits SrUGT G1 gene transcription, thereby inhibiting its expression.
Description
Transcription factor SrMYB for regulating stevioside synthesis, expression protein and application thereof Technical Field The invention belongs to the technical field of plant genetic engineering, and particularly relates to a transcription factor SrMYB for regulating and controlling stevioside synthesis, and an expression protein and application thereof. Background Stevia rebaudiana is a perennial herb plant of the Compositae, and stevioside rich in leaves of the stevia rebaudiana has the effects of high sweetness (about 300-400 times of sucrose), low calorie (about 1/300 of sucrose), and prevention and auxiliary treatment of diseases such as hypertension, diabetes, tumors and the like, is widely applied to the fields of foods, beverages, medicines and the like, and is also known as a sugar crop with the most development prospect after sugarcane and beet. As the most important secondary metabolic compound in stevia rebaudiana, the anabolic pathway of stevioside and the regulatory genes thereof have been research hot spots in the field. Through decades of research, steviol, which is a synthetic precursor of stevioside, is known to be produced through a MEP (methyl ethyl ketone) pathway, and then various steviosides are produced by adding different types and amounts of glycosyl groups at the C-13 and C-19 positions of stevioside transferase genes. It has now been found that more than 30 steviol glycosides, of which the ST and RA glycosides are highest in content, can account for 75-90% of the total glycosides content, have a better mouthfeel than ST glycosides, and are the most commonly used glycoside types in the market at present. With the continuous and intensive research of glycosides, a glycoside RM with the taste closest to sucrose is discovered in recent years, however, the content of the glycoside RM in stevia leaves is very low (about 0.4-0.5% of total glycosides), so how to increase the content of high-quality glycosides in stevia becomes a problem to be solved urgently. In the research of the glycosyltransferase gene in the glycosidic pathway, srUGT G1 gene has been found to promote the transformation of ST glycoside into RA glycoside and RD glycoside into RM glycoside, so SrUGT G1 gene becomes an important gene for improving glycoside quality. Searching for upstream regulatory factors will also affect the quality glycoside content in stevia leaves. MYB-type transcription factors are among the most abundant and functionally most abundant families of transcription factors in plants. The family proteins each contain one or more conserved domain-MYB domains consisting of 50-53 conserved amino acids. Depending on the number of MYB domains, the MYB transcription factor family can be divided into four types, 1R (R1/2, R3 MYB), 2R (R2R 3 MYB), 3R (R1R 2R3 MYB) and 4R (4R 1/R2 like). Wherein the 2R type MYB protein accounts for the vast majority of plant MYB proteins. MYB transcription factors can activate or inhibit the expression of downstream genes, participate in various life processes of plant growth and development, stress response, secondary metabolism and the like, but have not been reported in the aspect of regulating stevioside biosynthesis. Disclosure of Invention The invention aims to provide a transcription factor gene SrMYB for regulating stevioside biosynthesis, an expression protein and application thereof. The invention provides selectable candidate genes for regulating and controlling stevioside synthesis, and can promote high-quality glycoside synthesis by inhibiting expression of the genes in stevia rebaudiana, thereby having better application prospect. The invention realizes the above purpose through the following technical scheme: a stevia rebaudiana SrMYB gene has a nucleotide sequence shown in SEQ ID NO. 1. The amino acid sequence of the expression protein of the stevia rebaudiana SrMYB gene is shown as SEQ ID NO. 2. The primer pair for cloning and obtaining SrMYB gene has the primer sequence: SrMYB1-F: CTTAGCTTCCAGTCTGCCCC; SrMYB1-R: CCCTCTAGAAGGTTCACACCAG。 A vector or host bacterium containing the stevia SrMYB gene. The invention also provides an application of the transcription factor SrMYB in regulating stevioside biosynthesis. A further improvement is that the regulation of stevioside biosynthesis refers to regulation of key SrUGT G1 gene expression for stevioside RA and RM glycoside synthesis. A further improvement is that the transcription factor SrMYB reduces SrUGT G1 expression by inhibiting SrUGT G1 transcription. Compared with the prior art, the invention has the beneficial effects that: The invention provides a novel SrUGT G1 regulatory gene SrMYB, the full length 1074 bp of which codes for 357 amino acid residues. Subcellular localization researches show that the protein is mainly located in cell nuclei, yeast activation experiments show that the protein has transcription activation activity, yeast single hybridization experiments show that SrMYB1 can be combined wit