Search

CN-116083639-B - SNP (Single nucleotide polymorphism) marker linked with balsam pear for resisting meloidogyne disease of like-eared beans and application

CN116083639BCN 116083639 BCN116083639 BCN 116083639BCN-116083639-B

Abstract

The invention discloses a SNP marker linked with balsam pear for resisting the root-knot nematode disease of like auricularia auricula and application thereof. Through identification and genome-wide association analysis of 192 balsam pear germplasm like auricularia root-knot nematode collected from all over the world, the invention discovers that SNP site (G/A) exists at 2122-position base of coding region of balsam pear SEC8 gene, and the specific position is Chr4-25401664. And (3) amplifying the presence or absence of the detection band by designing a primer PCR, so as to judge the resistance of the balsam pear sample subject to the otorhinoceros root-knot nematode disease. The invention can rapidly and accurately analyze the resistance of different balsam pear species to the meloidogyne diseases of the balsam pear, and accelerates the application of a molecular marker assisted selection technology in balsam pear disease-resistant breeding.

Inventors

  • YANG YAN
  • YU RENBO
  • LIU JIE
  • NIU YU
  • HAN XU
  • LIU ZHAOHUA

Assignees

  • 中国热带农业科学院热带作物品种资源研究所

Dates

Publication Date
20260508
Application Date
20230307

Claims (4)

  1. 1. SNP marker linked with balsam pear anti-Izod root knot nematode disease, characterized in that it is positioned at 251 st base of sequence shown in SEQ ID NO. 4 or SEQ ID NO. 5, the base is G or A.
  2. 2. A primer pair for amplifying the SNP marker according to claim 1, comprising a first primer pair comprising primer Chr4-25401664-CGF and primer Chr4-25401664R and a second primer pair comprising primer Chr4-25401664-CAF and primer Chr4-25401664R; The nucleotide sequence of the primer Chr4-25401664-CGF is GGACTTGCCAAATTGTTTTAGGTCG; The nucleotide sequence of the primer Chr4-25401664R is AGAGCAGCAGACAAGGAACA; the nucleotide sequence of the primer Chr4-25401664-CAF is GGACTTGCCAAATTGTTTTAGGTCA.
  3. 3. Use of the SNP marker of claim 1 or the primer pair of claim 2 for identifying resistance to meloidogyne disease in balsam pear elephant-ear beans.
  4. 4. The method according to claim 3, wherein the method for judging the resistance of the balsam pear to the otobean root knot nematode disease comprises amplifying the balsam pear genome DNA by using the primer pair according to claim 2, wherein the material to be tested is a low-disease-resistant material if the product amplified by using the first primer pair has a band and the product amplified by using the second primer pair has no band, the material to be tested is a high-disease-resistant material if the product amplified by using the first primer pair has no band and the product amplified by using the second primer pair has a band, and the resistance of the material to be tested is medium if the amplified products of the first primer pair and the second primer pair have a band.

Description

SNP (Single nucleotide polymorphism) marker linked with balsam pear for resisting meloidogyne disease of like-eared beans and application Technical Field The invention relates to the technical field of molecular biology, in particular to SNP markers linked with balsam pear for resisting the root knot nematode disease of like auricularia auricula and application thereof. Background Bitter gourd is one of important winter melon vegetables in Hainan province, is rich in vitamins, has medicinal values of reducing blood sugar, reducing blood pressure, resisting tumor, resisting HIV and the like, expands the planting area year by year in recent years, and becomes an indispensable vegetable on a public dining table. However, the repeated cropping index is high, the continuous cropping obstacle is serious, the disease like the root-knot nematode of the otobean is common and aggravated year by year, and the yield and quality of the balsam pear are seriously affected. The root-knot nematode of the like-eared beans is found in the like-eared bean tree of Danzhou city in the Hainan province of China in 1983, and is considered to be a minority or a minor species for the last 20 years to be ignored. The host range of the meloidogyne (Meloidogyne enterolobii) of the like auricularia auricula is wide, and the meloidogyne auriculata comprises balsam pear, cucumber, capsicum, tomato and other vegetables. Unlike the southern root-knot nematodes (m. Incognita) and the northern root-knot nematodes (m. Hapla), the root-knot nematodes of the like auricularia auriculata are insensitive to the nematode-resistant genes of Mi, N and Rk, and can be parasitic propagated on resistant tomatoes and peppers, resulting in great losses to crops. The whole genome sequencing of the object Meloidogyne incognita in 2020 and Koutsovoulos is carried out, the genome size of the Meloidogyne incognita is 240Mbp, 59733 coding genes, 4068 non-coding genes and 10944 transposon elements are annotated, and a foundation is laid for the research of resisting the Meloidogyne incognita. Huang Weiming and the like find that cucumbers, balsam pears, towel gourds, pumpkins and the like in Hainan Wenchang, ling water, eastern and other places and that cucurbitaceae vegetables all find diseases such as otobean root knot nematode. The research results in recent years show that the root-knot nematodes of the like-earbeans are widely distributed in the Hainan island and become important nematode species of local Hainan crops, particularly melons and vegetables, so that how to effectively prevent and treat the root-knot nematodes of the like-earbeans is a key problem which needs to be solved in balsam pear production. The existing researches show that continuous irrigation with large water and crop rotation for resisting the root-knot nematode of the like beans and the use of chemical agents can effectively prevent and treat the root-knot nematode of the like beans, but the water resource deficiency and crop rotation for resisting the root-knot nematode can cause economic loss to a certain extent, the chemical agents are high in price and pollute the environment, and the grain safety problem is brought. The research shows that the screening of germplasm against the root knot nematode disease of the like-eared beans from the existing balsam pear germplasm resources is important. Disclosure of Invention In view of the above, the invention provides a SNP marker linked to balsam pear for resisting the meloidogyne disease of the like auricularia auricula, and application thereof. The invention can sample and detect whether disease resistance is detected in the seedling stage of the balsam pear, and provides support for the application of molecular marker assisted breeding technology in balsam pear breeding. Through identification and genome-wide association analysis of 192 parts of balsam pear germplasm collected from all parts of the world, the invention discovers a SNP marker linked with balsam pear anti-Izod, which is positioned at 2122 nd base of a coding region of a balsam pear SEC8 gene, and the specific position is Chr4-25401664, and the base is G or A. The Sequence of the SNP locus is shown as SEQ ID NO. 4 (Sequence 1) and SEQ ID NO. 5 (Sequence 2) in the Sequence table. The SNP locus is positioned at the 251 st position of the sequence shown in SEQ ID NO. 4 or SEQ ID NO. 5. Wherein Sequence 1 is closely linked to the root-knot nematode disease of the Izornia species, and Sequence 2 is closely linked to the root-knot nematode disease of the Izornia species. Further, the invention also provides a primer pair for amplifying the SNP marker, which comprises a first primer pair and a second primer pair, wherein the first primer pair comprises a primer Chr4-25401664-CGF and a primer Chr4-25401664R, and the second primer pair comprises a primer Chr4-25401664-CAF and a primer Chr4-25401664R; The nucleotide sequence of the primer Chr4-25401664-CGF is GGACTTGCCAAATTGTTTTAGGT