CN-116287302-B - Molecular marker for rapidly identifying genetic sex of early-stage cheilinus comatus and application thereof
Abstract
The invention relates to a molecular marker, in particular to a molecular marker for rapidly identifying the genetic sex of early-stage cheilinus comilinus and a sex identification method of cheilinus comilinus. Belongs to the technical field of fish sex identification. A method for quickly identifying the genetic sex of the cheilinus comatus includes such steps as preparing DNA extract, PCR amplification to obtain PCR product, agarose gel electrophoresis to obtain primer with nucleotide sequence GGTCAACAAACAAACTCTCCTCGATT, and judging that if 2 bands are shown, only one band is male and only one band is female. The molecular marker provided by the invention can be used for cultivating full-female or high female specific lipfish, and is beneficial to the rapid development of the industrial chain.
Inventors
- ZHENG JIANBO
- LI FEI
- JIANG JIANHU
- GUO JIANLIN
- LIU SHILI
- CHENG SHUN
- CHI MEILI
- JIANG WENPING
- LIU YINUO
Assignees
- 浙江省淡水水产研究所
Dates
- Publication Date
- 20260512
- Application Date
- 20230221
Claims (6)
- 1. A method of identifying the genetic sex of a cheilinus comatus comprising the steps of: a. preparing a DNA extracting solution, namely crushing tissues in a centrifuge tube, adding a DNA lysate and Proteinase K, incubating, heating a metal bath, cooling to room temperature, and centrifuging to obtain a supernatant which is a DNA crude extracting solution; b. performing PCR amplification reaction by taking the extracted DNA crude extract as a template to obtain a PCR product, wherein the nucleotide sequence of an upstream primer of the PCR amplification is SEQ ID NO 2:TTTCAACTGTTGCAAAGAGTC, and the nucleotide sequence of a downstream primer is SEQ ID NO 3:GCCATTCCTCGAAAATCTGCATAAC; c. The PCR products were subjected to agarose gel electrophoresis, and the result showed that if the electrophoresis result showed 2 bands, it was male, and if only a single band was female.
- 2. The method according to claim 1, wherein in step a), the DNA lysate is unimersal DNAzol in an amount of 200. Mu.L, and the Proteinase K has a specification of 20mg/mL and an amount of 2. Mu.L.
- 3. The method according to claim 2, wherein in step a), a small amount of skein tissue is sheared, tissue disruption is performed in a 1.5mL centrifuge tube, 200. Mu.L of unitary DNAzol lysate and 20mg/mL of protease K2. Mu.L are added, incubation is performed for 30min at 55 ℃, then a 95 ℃ metal bath is heated for 5min and cooled to room temperature, and tissue material is precipitated by slight centrifugation at room temperature, and the supernatant is the crude DNA extract.
- 4. The method according to claim 1, wherein in the step b), the PCR reaction system comprises 2. Mu.L of the DNA template and 2x Super Pfx MasterMix 12.5. Mu.L of each of the upstream and downstream primers, and the amount of the sterilized water is up to 25. Mu.L.
- 5. The method according to claim 1, wherein in step b), the PCR reaction is carried out at 98℃in 1min, 98℃in 10s, 55℃in 20s, 72℃in 30s, 35 cycles, 72℃in 5min.
- 6. The method according to claim 1, wherein in step c) the agarose gel concentration is 1%.
Description
Molecular marker for rapidly identifying genetic sex of early-stage cheilinus comatus and application thereof Technical Field The invention relates to a molecular marker, in particular to a molecular marker for rapidly identifying the genetic sex of early-stage cheilinus comatus and application thereof. Belongs to the technical field of fish sex identification. Background The cheilinus (Acrossocheilus fasciatus) is commonly called as freshwater stone spots, belongs to the families of Cyprinidae (CYPRINIDAE), cheilidae (Barbinae) and cheilinus (Acrossocheilus), and is naturally living in a rapid flow environment in mountain stream or upstream in a river. At present, the special brook fish with high economic value is popularized and cultivated, and the special brook fish is a small economic fish which is developed in Zhexi mountain area in recent years. The lipfish has typical sex binary growth characteristics, namely the growth speed of female fish is obviously faster than that of male fish, so that the full female or high female specific fingerling cultivation by breaking through the single breeding technology can be beneficial to improving the cultivation yield and economic benefit. Therefore, the development of the molecular marker closely linked with the sex of the cheilinus comatus is a key factor for implementing the technology of the whole female monospecific breeding, and can also provide important information for revealing the sex determination regulation mechanism of the cheilinus comatus. The Chinese patent application No. CN1880478A discloses a female specific AFLP fragment of cynoglossus semilaevis and a PCR method for genetic sex identification, which has the advantages of rapidness, accuracy, sensitivity and the like, but is not suitable for sex identification of the cynoglossus semilaevis. At present, no report related to effective sex-linked molecular markers of the cheilinus fasciatus is seen. Disclosure of Invention The invention aims to provide a DNA molecular marker suitable for rapidly identifying the genetic sex of early-stage cheilinus lucidus. Provides important data support for the culture and sex regulation mechanism of the full female fries of the cheilinus lucidus. In order to achieve the above purpose, the specific technical scheme of the invention is as follows: A molecular marker for quickly identifying the genetic sex of early-stage cheilinus fasciatus features that its nucleotide sequence is SEQ ID NO 1:GGTCAACAAACAACTCTCCTCGATT. The invention firstly provides a specific molecular marker obtained based on a 2b-RAD simplified genome high-throughput sequencing technology. To facilitate rapid detection of the genetic sex of young cheilis by PCR means. It is another object of the present invention to provide a primer pair for detecting the molecular marker. The primer pair for detecting the molecular marker comprises an upstream primer and a downstream primer, wherein the nucleotide sequence of the upstream primer is SEQ ID NO 2:TTTCAACTGTTGCAAAGAGTC, and the nucleotide sequence of the downstream primer is SEQ ID NO 3:GCCATTCCTTGAAAATCTGCAAC. The invention carries out Survey analysis on the genome of the lipfish, obtains the sequences at two ends of the molecular marker according to the Survey result, and simultaneously provides a primer pair for detecting the molecular marker, namely SEQ ID NO 2 and SEQ ID NO 3. The invention further provides a method for rapidly identifying the genetic sex of the cheilinus comatus by PCR amplification through the specific marker. A method for rapidly identifying the genetic sex of a cheilinus comatus, comprising the steps of: a. Preparing a DNA extracting solution, shearing a small amount of tail fin tissues, crushing the tissues in a centrifuge tube, adding a DNA lysate and protease K, incubating, heating a metal bath, cooling to room temperature, and centrifuging to obtain a supernatant which is a DNA crude extracting solution; b. Performing PCR amplification reaction by taking the extracted DNA crude extract as a template to obtain a PCR product, wherein the primer is the specific molecular marker of claim 1; c. The PCR products were subjected to agarose gel electrophoresis, and the result showed that if the electrophoresis result showed 2 bands, it was male, and if only a single band was female. As a preferred embodiment, in step a), the DNA extract is prepared by a rapid nucleic acid cleavage method. As a preferable mode of the technical scheme, in the step a), the DNA lysate is univing DNAzol, the dosage is 200 mu L, the specification of protease K is 20mg/mL, and the dosage is 2 mu L. As the technical scheme, in the step a), the specific operation is that a DNA extracting solution is prepared by a rapid nucleic acid cleavage method, a small amount of tail fin tissues are sheared, the tissues are crushed in a 1.5mL centrifuge tube, 200 mu L of unitary DNAzol lysate and 20mg/mL of protease K2 mu L are added for incubation for 30min at 55