Search

CN-116718769-B - Composition for imaging and treating liver cancer

CN116718769BCN 116718769 BCN116718769 BCN 116718769BCN-116718769-B

Abstract

A composition for imaging and treating liver cancer relates to the field of tumor detection, and realizes efficient and accurate cancer tissue identification by identifying specific markers on the surface of tumor cells or tissues, so that liver cancer markers with great potential are found.

Inventors

  • YAN CHUNRU
  • WU WENWEI
  • LI LIANGCHENG
  • QIAN LIXIA

Assignees

  • 厦门大学
  • 博生众康(厦门)医药生物技术股份有限公司

Dates

Publication Date
20260508
Application Date
20230529

Claims (6)

  1. 1. A visual imaging composition comprising a nucleic acid aptamer, wherein the nucleic acid aptamer comprises APT13, wherein the nucleic acid aptamer is labeled with a fluorescent dye, and wherein the APT13 has a sequence of ATTGGCACTCCACGCATAGGCACACGGGGGGGTGGGTTGGGTTCTGTGCTGTGATCATCATTCACGGTAGCACGCATAGG.
  2. 2. The composition of claim 1, wherein the fluorescent dye is selected from the group consisting of 6-FAM and cyanine fluorescent dyes.
  3. 3. The composition of claim 2, wherein the fluorescent dye is Cy3.
  4. 4. The composition of any one of claims 1-3, further comprising screening the Library for sequence SEQ ID NO. 1 and a negative control Mock sequence SEQ ID NO. 2.
  5. 5. Use of a composition according to any one of claims 1-4 for the preparation of a tumor tissue identification agent.
  6. 6. The use according to claim 5, wherein the tumor tissue is liver cancer tissue, or liver cancer cells.

Description

Composition for imaging and treating liver cancer Technical Field The invention relates to the field of tumor detection, in particular to a composition for imaging and treating liver cancer. Background Malignant tumors are serious diseases that threaten human life, and their mortality occupies position 1 of the human disease spectrum. Wherein hepatocellular carcinoma (Hepatocellulaur carcinoma, HCC)) is the third largest tumor worldwide. It has been reported that hepatectomy (LR), radiofrequency ablation (RFA), liver Transplantation (LT) and the like are currently a therapeutically effective means for early and medium stage HCC, whereas HCC has a high recurrence rate after late surgery, poor prognosis, survival rate of only 23.8%, and end stage or even less than 2%. However, early liver cancer is hidden in onset, symptoms and signs are not obvious, and most patients lack general investigation consciousness, so that the early diagnosis rate of HCC is low, patients frequently see medical treatment for middle and late stages, and the treatment opportunity is lost. Up to now, according to the documents of "diagnosis and treatment Specification for primary liver cancer (2019)", "layered screening and monitoring guidelines for primary liver cancer (2020 edition)", and "diagnosis and treatment of precancerous lesions of hepatocellular carcinoma (2020 edition)", and the like, it is pointed out that Computed Tomography (CT), B-ultrasonic and Magnetic Resonance Imaging (MRI) are still the most commonly used tools for liver cancer detection at present, and although technological progress greatly improves the diagnosis performance of HCC, there are limitations in diagnosing early liver cancer, and for liver cancer with diameter <2cm, the sensitivity of ultrasonic detection is divided into 39%, and the detection cost is high, so that extensive screening cannot be performed at present, and sensitivity and specificity are highly dependent on instrument performance and experience of doctors, and most of them are only diagnosed after liver cancer has progressed to late stage, resulting in that the median of survival of liver cancer patients is less than 1 year. At present, no better strategy exists for treatment, and effective screening and early diagnosis of HCC (infectious bronchitis) of high-risk groups are effective ways for improving survival rate and reducing death rate. The biomarker has the most advantage for early detection and diagnosis of small liver cancer. Alpha Fetoprotein (AFP) is by far the most clinically used biomarker for liver cancer screening, early diagnosis, efficacy assessment and prognosis. However, the clinical diagnostic accuracy of AFP is not satisfactory due to low sensitivity and specificity, and about 30% to 40% of HCC patients clinically are negative for serum AFP. However, in addition to AFP as a diagnostic marker for liver cancer, there are also many biomarkers internationally used for co-detection with AFP to increase accuracy, such as DCP, AFP-L3, OPN, GPC3, GP73, dickkopf-1, PIVKA-II and Lipocalin-2, but these markers are not advantageous in terms of specificity and sensitivity as compared with AFP. PPP1CA is a catalytic subunit of protein phosphatase 1alpha, since the discovery of the group of Li Liangcheng professor No. 2015, the RNA and protein expression levels of PPP1CA are obviously higher than those of normal and paracancerous tissues (authorized number: ZL 201710308690.0) in exosomes secreted by hepatic primary cells of early liver cancer tissues of patients, and the PPP1CA has a very high expression rate in liver cancer cells with negative AFP expression, is an early warning biomarker, overcomes the sensitivity of early screening of AFP, and can make up the deficiency of AFP to a certain extent. PPP1CA is a novel liver cancer marker with great potential, however, no specific recognition PPP1CA molecular imaging probe is applied clinically at present. In recent years, molecular imaging has received a great deal of attention in biomedical research and clinical diagnosis as a rapidly growing field. Unlike conventional imaging techniques based on morphological information, molecular imaging typically uses specific molecular probes to image specific cells, tissues, or living organisms. The design and manufacture of these molecular imaging probes enables the investigation of molecular level abnormalities in a non-invasive, real-time and in situ manner, thereby providing the potential for achieving specific diagnosis of diseases such as cancer in vivo or in vitro. Therefore, it is necessary to develop a molecular detection probe that specifically and affinity recognizes PPP1 CA. Disclosure of Invention Nucleic acid Aptamer (Aptamer) is a relatively new and promising single-stranded oligonucleotide (SsDNA/RNA) has unique binding properties for different targets including cancer markers, cells, tissues and living organisms. Not only does the aptamer have excellent affinity and specificit