CN-118813568-B - Glycosyltransferase UGT76G1 mutant and application thereof
Abstract
The invention discloses a glycosyltransferase UGT76G1 mutant, which is (a) protein with an amino acid sequence shown as SEQ ID NO.3, or (b) protein which is derived from (a) and has the enzymatic activity of catalyzing rebaudioside D to be rebaudioside M through substituting, deleting or adding one or more amino acid sequences in the amino acid sequence shown as SEQ ID NO. 3. The invention also discloses a gene sequence and the like for encoding the glycosyltransferase UGT76G1 mutant as claimed in claim 1. According to the invention, the enzyme activity of the glycosyltransferase UGT76G1 is obviously improved through site-directed mutagenesis, and compared with the wild glycosyltransferase UGT76G1, the optimal mutant enzyme activity is improved by 4.72 times, so that the use amount of the enzyme can be obviously reduced. According to the invention, the glycosyltransferase UGT76G1 mutant and sucrose synthase SUS are respectively subjected to heterologous expression in Pichia pastoris, purification is not needed, a cyclic regeneration system of UDP-UDPG is constructed by using crude enzyme liquid, and the addition of UDPG as a glycosyl donor is avoided, so that the cost can be obviously reduced.
Inventors
- ZHANG MINGYI
- PING QIAN
- DONG GUOMING
- DOU PEICHONG
- ZHANG LIANLIAN
- WANG SHAOPEI
- ZHU MENGDAN
Assignees
- 铭诚惠众(江苏)药物研究有限公司
Dates
- Publication Date
- 20260505
- Application Date
- 20240708
Claims (11)
- 1. A glycosyltransferase UGT76G1 mutant, wherein the mutant is: The amino acid sequence of the protein is shown as SEQ ID NO. 3.
- 2. A gene sequence encoding the glycosyltransferase UGT76G1 mutant of claim 1.
- 3. Method for the preparation of a glycosyltransferase UGT76G1 mutant according to claim 1, characterized in that it comprises the steps of: s1, obtaining an amino acid sequence of glycosyltransferase UGT76G1 from Genbank according to an accession number AGL95113.1, and optimizing the sequence according to codon preference of pichia pastoris to obtain a codon optimized UGT76G1 gene sequence; S2, performing total gene synthesis and connecting the total gene synthesis to a polyclonal enzyme cutting site of a vector pPICZA to obtain a recombinant plasmid pPICZA-UGT76G1; s3, carrying out full plasmid PCR by taking a recombinant plasmid pPICZA-UGT76G1 as a template, and sequentially carrying out four rounds of site-directed mutagenesis to construct a corresponding recombinant plasmid carrying mutants; s4, the recombinant plasmid identified as correct is transformed into host bacteria to obtain a transformant; s5, fermenting the obtained transformant to obtain a glycosyltransferase UGT76G1 mutant; The primer pair sequences for four rounds of site-directed mutagenesis in step S3 are as follows: P84H-F:TGGTCATTTGGCTGGTATGAGGATTCCAATTATTAATGAAC; P84H-R:ATACCAGCCAAATGACCATGAGTTGGCAAATTAGAAATTCTTTCA; I199A-F:CAAGCTTTGAAAGAAATTTTGGGTAAAATGATTAAACAAACTAGAG; I199A-R:AATTTCTTTCAACGATTGCCAGTTAGAATAAGCAGATTTAATATCCTTAAC; T284S-F:TTCTTCTTCTGAAGTTGATGAAAAAGATTTTTTGGAAATTGC; T284S-R:TCAACTTCAGAAGAAGAACCAAAAGAAACATACAAAACAGAAGATG; W359F-F:ATTCTTTTTGGAACTCTACTTTGGAATCTGTTTGTGAAGG; W359F-R:TAGAGTTAAAACCAGAATGAGTCCAAAAAGCACC。
- 4. the method of claim 3, wherein the sequence of the codon optimized UGT76G1 gene in step S1 is set forth in SEQ ID No. 1.
- 5. A recombinant expression vector cloned with a gene sequence encoding the glycosyltransferase UGT76G1 mutant of claim 1.
- 6. A recombinant strain of Pichia pastoris, wherein the recombinant strain is cloned with the recombinant expression vector of claim 5.
- 7. The recombinant strain of pichia pastoris according to claim 6, wherein the recombinant strain is obtained by transforming the recombinant expression vector of claim 5 into pichia pastoris X33.
- 8. A method for synthesizing rebaudioside M, wherein the method uses the glycosyltransferase UGT76G1 mutant and sucrose synthase SUS as a combination, and uses rebaudioside D as a substrate to perform a catalytic reaction to obtain the rebaudioside M.
- 9. The method of synthesis according to claim 8, wherein the sequence of the gene encoding sucrose synthase SUS is shown in SEQ ID NO. 2.
- 10. The method according to claim 8, wherein the reaction temperature of the catalytic reaction is 40 ℃, and the reaction system in 10mL comprises: 100mM potassium phosphate buffer, 400mM sucrose, 0.8mM UDP, 20G/L Reb D, 10mg sucrose synthase SUS, 50mg glycosyltransferase UGT76G1; the pH of the 100mM potassium phosphate buffer was 8.0, containing 100mM NaCl.
- 11. Use of the glycosyltransferase UGT76G1 mutant according to claim 1 for catalyzing the synthesis of rebaudioside M from rebaudioside D.
Description
Glycosyltransferase UGT76G1 mutant and application thereof Technical Field The invention belongs to the technical field of biological enzyme engineering, and particularly relates to a glycosyltransferase UGT76G1 mutant and application thereof. Background With the improvement of living standard, healthy diet is one of the daily pursuits of people today. Among them, excessive ingestion of sugar causes an excessive burden on the body, which can lead to the occurrence of various chronic diseases. Therefore, steviol glycoside compounds derived from stevia rebaudiana have received attention because of their high sweetness, low calories and high safety. Wherein stevioside (5-10% of the dry weight of the leaves) and rebaudioside A (Reb A, 2-4% of the dry weight of the leaves) are the two most abundant components, and are the main components of steviol glycoside additives which are commercially available in the market at present. They have a sweetness of 250-300 times that of sucrose, but the presence of a bitter aftertaste other than sweet taste on the mouthfeel severely affects their mouthfeel as sweeteners. While rebaudioside M (Reb M) with a smaller content in steviol glycosides has a higher sweetness than Reb a and steviol, and reduces the afterbitterness outside of sweetness, and sweetness faster and thus a better mouthfeel as a sweetener, is considered to be a very potential next generation sweetener. However, the content of Reb M in the dry stevia leaf is only 0.4% -0.5%, which is only about one tenth of the content of Reb a, and the complicated and complicated extraction method makes it difficult to realize large-scale production and also difficult to meet market demands. The biosynthetic preparation of Reb M is one of the key directions of research in recent years. Glycosyltransferase UGT76G1 is capable of catalyzing Reb D to Reb M in the presence of uridine diphosphate glucose (UDPG), but its wild-type enzyme has low enzymatic activity, so it is necessary to continue to develop a high-activity, high-conversion process. Meanwhile, UGT76G1 also needs to use UDPG as a glycosyl donor, and the UDPG has high market price, so that the industrialized production is limited to a certain extent. Disclosure of Invention In order to solve the problems in the prior art, the invention successfully obtains the mutant with high enzyme activity by carrying out structural transformation on glycosyltransferase UGT76G1, combines the optimal mutant with sucrose synthase SUS, establishes a UDPG circulation regeneration system, and avoids the additional addition of expensive UDPG, thereby providing a new method for the production of Reb M. Accordingly, in a first aspect of the present invention, there is provided a glycosyltransferase UGT76G1 mutant, said mutant being: (a) Protein with the amino acid sequence shown as SEQ ID NO.3, or (B) A protein derived from (a) which has been substituted, deleted or added with one or more amino acid sequences in the amino acid sequence shown in SEQ ID NO.3 and has an enzymatic activity of catalyzing rebaudioside D to rebaudioside M. In a second aspect of the invention, a gene sequence encoding said glycosyltransferase UGT76G1 mutant is provided. In a third aspect of the present invention, there is provided a method for preparing the glycosyltransferase UGT76G1 mutant, comprising the steps of: s1, obtaining an amino acid sequence of glycosyltransferase UGT76G1 from Genbank according to an accession number AGL95113.1, and optimizing the sequence according to codon preference of pichia pastoris to obtain a codon optimized UGT76G1 gene sequence; S2, performing total gene synthesis and connecting the total gene synthesis to a polyclonal enzyme cutting site of a vector pPICZA to obtain a recombinant plasmid pPICZA-UGT76G1; s3, carrying out full plasmid PCR by taking a recombinant plasmid pPICZA-UGT76G1 as a template, and sequentially carrying out four rounds of site-directed mutagenesis to construct a corresponding recombinant plasmid carrying mutants; s4, the recombinant plasmid identified as correct is transformed into host bacteria to obtain a transformant; s5, fermenting the obtained transformant to obtain a glycosyltransferase UGT76G1 mutant; The primer pair sequences for four rounds of site-directed mutagenesis in step S3 are as follows: P84H-F:TGGTCATTTGGCTGGTATGAGGATTCCAATTATTAATGAAC;(SEQ ID NO.4) P84H-R:ATACCAGCCAAATGACCATGAGTTGGCAAATTAGAAATTCTTTCA;(SEQ ID NO.5) I199A-F:CAAGCTTTGAAAGAAATTTTGGGTAAAATGATTAAACAAACTAGAG;(SEQ ID NO.6) I199A-R:AATTTCTTTCAACGATTGCCAGTTAGAATAAGCAGATTTAATATCCTTAAC;(SEQ ID NO.7) T284S-F:TTCTTCTTCTGAAGTTGATGAAAAAGATTTTTTGGAAATTGC;(SEQ ID NO.8) T284S-R:TCAACTTCAGAAGAAGAACCAAAAGAAACATACAAAACAGAAGATG;(SEQ ID NO.9) W359F-F:ATTCTTTTTGGAACTCTACTTTGGAATCTGTTTGTGAAGG;(SEQ ID NO.10) W359F-R:TAGAGTTAAAACCAGAATGAGTCCAAAAAGCACC;(SEQ ID NO.11) according to a preferred embodiment of the present invention, the sequence of the codon optimized UGT76G1 gene described in step S1 is sho