CN-119040342-B - Soybean expansin gene GmEXPA and application thereof

CN119040342BCN 119040342 BCN119040342 BCN 119040342BCN-119040342-B

Abstract

The invention relates to the technical field of genetic engineering, in particular to a soybean expansin gene GmEXPA and application thereof, wherein GmEXPA is expressed in soybean pod dominance, an open reading frame 747bp is used for encoding 248 amino acid residues. Further analysis of the invention shows that GmEXPA10 overexpression obviously increases the root length of transgenic arabidopsis thaliana, and the increase amplitude is larger under the acid bias condition, gmEXPA10 overexpression obviously increases the length and width of the pod of transgenic arabidopsis thaliana, and GmEXPA expression in the pod is induced by gibberellin. Analysis of allelic variation of GmEXPA for different soybean varieties revealed that a single SNP (C/A) located downstream of the gene can classify soybean sources into two types, and there are significant differences in hundred grain weight, grain width, etc. between the types, indicating that the SNP locus is related to soybean grain size and weight.

Inventors

LI NA
SHAO ZHENQI
LI WENLONG
LI XIHUAN
ZHANG CAIYING

Assignees

河北农业大学

Dates

Publication Date: 20260505
Application Date: 20240830

Claims (1)

1. The application of the soybean expansin gene GmEXPA in improving the length and width of the pod of the plant is characterized in that the open reading frame sequence of the soybean expansin gene GmEXPA is shown as SEQ ID No.1 or The amino acid sequence of the soybean expansin gene GmEXPA is shown as SEQ ID No. 2; the application mode is that the soybean expansin gene GmEXPA is overexpressed in plant cells, so that the expression quantity of the soybean expansin gene GmEXPA is improved; the plant is soybean and/or Arabidopsis thaliana.

Description

Soybean expansin gene GmEXPA and application thereof Technical Field The invention relates to the technical field of genetic engineering, and particularly provides a soybean expansin gene GmEXPA and application thereof. Background The soybean is an important grain and oil crop, supplies 69% of vegetable protein and 27% of vegetable oil and fat worldwide, not only provides various amino acids and unsaturated fatty acids necessary for human body, but also can be used as feed for livestock and aquaculture. But the yield is relatively low compared with other crops, and the requirements are far from being met. Therefore, the improvement of the soybean unit yield level is an important breeding target in the current stage of China. Expansin is a loose protein located on the plant cell wall and plays an important role in plant growth and development, yield and quality trait formation and resistance to various biotic and abiotic stresses. Currently, expansins have been considered as the only cell wall relaxase in vitro that is capable of restoring extensibility to heat-inactivated cell walls and are key factors in regulating plant acid growth. The expansins identified in plants can be generally classified into 4 classes, namely alpha-Expansin (EXPA), beta-Expansin (EXPB), alpha-Expansin (EXLA) class, beta-Expansin (EXLB) class. It has been shown by experiments that α -expansin and β -expansin have an important role in causing relaxation of plant cell walls. It has been found that it has very important regulatory effects on the normal growth and development of the whole plant, including seed germination, root system development, leaf growth, internode elongation, fruit softening, pollen tube elongation, organ abscission, stomata opening and closing, and the like. At present, functional researches on the development of the soybean root system and nodulation and nitrogen fixation of the expansin gene are reported. Cho et al studied expansins AtEXP and AtEXP using Arabidopsis mutants and found that specific expression of both genes promoted Arabidopsis root hair growth. Lee and other researches show that the soybean expansin GmEXP is mainly expressed in root tip epidermal cells of primary and secondary roots, and the root growth capacity of the tobacco with over-expression GmEXP1 is obviously enhanced. Ren Mingxuan and the like clone the full-length sequence of the expansin gene GmEXPA41 in dwarf soybeans, and through bioinformatics analysis, the cell elongation is primarily considered to be possibly related, then the cell elongation is constructed into an escherichia coli expression vector pET32a, BL2UDE3 is transformed, prokaryotic expression and SDS-PAGE analysis are carried out, a high-yield strain is obtained through screening, fermentation culture is carried out on the strain by means of a fermentation tank, and a foundation is laid for separation and purification of later soybean expansin. Wang Duojia and the like clone an expansin gene Cs-EXPA2 in the cucumber dwarf mutant by adopting an RT-PCR method, and the result of analyzing mRNA expression difference in the growth process of 88 hours in the seedling stage shows that the Cs-EXPA2 has an important regulation and control effect on the phenotype of the cucumber dwarf mutant. However, the expansin gene has less reports on plant yield formation studies. Therefore, the research on the function of soybean expansin gene in plant yield formation is of great importance for the comprehensive understanding of its biological function. Disclosure of Invention In view of this, the present invention provides an expansin gene GmEXPA related to soybean yield, which provides an important functional gene for further improving soybean yield level. In a first aspect of the present invention, the present invention provides a soybean expansin gene GmEXPA, wherein the open reading frame sequence of the soybean expansin gene GmEXPA is shown in SEQ ID No. 1. SEQ ID No.1：ATGGTGCTTTTGGGACTTCTCATGGTGGGATTTCTTTCTCTGGGTTCATTTGTCTCAGCTTCTGGTTATGGTTGGATGGATGCTCATGCAACCTTCTATGGAGGGGGTGATGCCTCAGGCACCATGGGTGGAGCATGTGGATATGGGAACTTGTACAGCCAGGGCTATGGAACAAACACTGCTGCTTTGAGCACAGCTTTGTTCAACAATGGTTTAAGCTGTGGGGCATGTTTTGAGATAAAGTGTGTTAACGACCAAAGGTGGTGCCTTCCACGCTCAGTTATTGTCACTGCAACCAATTTCTGTCCCCCAAACAATGCACTCCCTAATAATGCAGGTGGATGGTGTAACCCTCCCCTTCACCACTTCGACCTTTCCCAACCTATTTTCCAACAAATTGCTCAATACAAAGCTGGAATAGTACCCGTGGCTTACCGAAGGGTCCCTTGCCGAAAGAGAGAGGGCATCAGATTCACCATCAACGGTCACTCATACTTCAACCTAGTCCTAATTTCCAACGTTGGAGGTGCAGGTGATGTTCACGCAGTTTCCATCAAAGGATCAAGAACAAATTGGCAACCAATGACCAGAAACTGGGGTCAGAACTGGCAAAGCAACGCCTATCTCAACGGACAAAGCCTCTCCTTCAAGGTCACCACTAGCGACGGACACACCGTGGTCTCTAATAATGTTGCACCCTCAAGCTGGTCCTTTGGCCAAACCTTCAATGGCCACCAATTCATTTAA. The amino acid sequence of the soybean expansin gene GmEXPA is shown as SEQ ID No. 2. SEQ ID No.2：MVLLGLLMVGFLSLGSFVSASGYGWMDAHATFYGGGDASGTMGGACGYGNLYSQGYGTNTAALSTALFNNGLSCGACFEIKCVNDQRWCLPRSVIVTATNFCPPNNALPNNAGGWCNPPLHHFDLSQPIFQQIAQYKAGIVPVAYRRVPCRKREGIRFTINGHSYFNLVLISNVGGAGDVHAVSIK