CN-120272479-B - Salt-inducible promoter PagVQ Pro and application thereof

Abstract

The invention relates to a salt-inducible promoter PagVQ Pro and application thereof, and relates to the technical field of plant genetic engineering, wherein the nucleotide sequence of the promoter PagVQ5Pro is shown as SEQ ID NO. 1. According to GUS staining results, the transgenic lines PagVQ Pro-OE1 and 3 over-expressing the poplar promoter PagVQ Pro can obviously enhance GUS staining activity under the salt induction condition, so that the fact that the poplar promoter PagVQ5Pro is subjected to salt induction expression is proved, and a theoretical basis is laid for application of the transgenic lines in stress-tolerant breeding.

Inventors

• YAN HANWEI
• ZHANG XINYUAN
• LIU YANGLIN
• DONG LINGLI
• LI JINBIAO
• ZHANG LIPING

Assignees

• 安徽农业大学

Dates

Publication Date

20260508

Application Date

20250331

Claims (8)

1. 1. A salt inducible promoter PagVQ Pro is characterized in that the nucleotide sequence of the promoter PagVQ5Pro is shown in SEQ ID NO. 1.
2. 2. An over-expression vector, which is characterized in that, the over-expression vector comprising the promoter PagVQ Pro as defined in claim 1.
3. 3. An over-expression vector according to claim 2, wherein said over-expression vector is pMDC164,164.
4. 4. A genetically engineered bacterium, characterized in that the genetically engineered bacterium comprises the over-expression vector according to any one of claims 2-3.
5. 5. The genetically engineered bacterium of claim 4, wherein the genetically engineered bacterium is an agrobacterium.
6. 6. Use of the salt inducible expression promoter PagVQ Pro of claim 1 in salt stress inducible expression of plants, wherein the plants are poplar.
7. 7. The use according to claim 6, wherein the promoter PagVQ Pro drives expression of the gene of interest under salt stress induction in plants.
8. 8. The method for obtaining salt-inducible expression promoter PagVQ Pro according to claim 1, wherein the nucleotide sequence of PagVQ Pro is obtained by cloning by using the nucleotide sequence shown in SEQ ID NO.1 as a template and using a DNA molecular cloning technique, wherein the primer sequences of the DNA molecular cloning are as follows: SEQ ID NO.2:GGATCAAGCCTCAAAATACCT; SEQ ID NO.3:AGTGCGGCCTAACTATACCTT。

Description

Salt-inducible promoter PagVQ Pro and application thereof Technical Field The invention belongs to the technical field of plant genetic engineering, and particularly relates to a salt inducible promoter PagVQ Pro and application thereof. Background Poplar (populus l.) is widely used as an important fast-growing wood tree species in papermaking, ecological restoration and carbon-transfer construction, however, soil salinization severely restricts the planting range and productivity thereof, salt stress causes ion imbalance of poplar, damage of a membrane system and growth inhibition, and improvement of salt tolerance thereof through genetic improvement is highly demanded. At present, plant salt tolerance gene engineering focuses on the overexpression of functional genes (such as ion transport proteins and antioxidant enzyme genes), but constitutive expression of the plant salt tolerance gene engineering can cause energy consumption or growth inhibition under non-stress conditions, so that development of stress-inducible promoters (such as salt stress-inducible promoters) is a key for improving the safety and effectiveness of transgenes. The research shows that the CDM1 promoter cloned from the arabidopsis CDM1 gene promoter region has obvious salt induction on the expression quantity, and the rice promoter POsSalt can specifically start exogenous genes to express in plants when being subjected to salt stress, which indicates that promoter elements responding to the salt stress exist in the plants, can regulate and control the expression of related genes under the salt stress condition, thus possibly participating in the salt tolerance mechanism of the plants, has larger application value in agricultural biotechnology, however, the research on stress induction type promoters of poplar is less at present. For this purpose, the invention provides a salt inducible promoter PagVQ Pro and its use. Disclosure of Invention The present invention aims to solve the above problems and provide a salt inducible promoter PagVQ Pro and its use. The invention realizes the above purpose through the following technical scheme: The invention provides a salt-inducible promoter PagVQ Pro, and the nucleotide sequence of the promoter PagVQ Pro is shown as SEQ ID NO. 1. The invention also provides an over-expression vector which contains the promoter PagVQ Pro. As a further optimization scheme of the invention, the over-expression vector is pMDC-164. The invention also provides a genetically engineered bacterium, which contains the over-expression vector. As a further optimization scheme of the invention, the genetically engineered bacteria are agrobacterium. The invention also provides an application of the salt inducible promoter PagVQ Pro in plant salt stress induced expression. As a further optimization scheme of the invention, the promoter PagVQ Pro drives the target gene expression under the induction of salt stress of poplar. As a further optimization of the invention, the plant is poplar. The invention also provides a method for obtaining the salt-induced expression promoter PagVQ Pro, which takes the nucleotide sequence shown in SEQ ID NO.1 as a template, and uses a DNA molecular cloning technology to clone to obtain the nucleotide sequence of PagVQ5Pro, wherein the primer sequence of the DNA molecular cloning is as follows: SEQ ID NO.2:GGATCAAGCCTCAAAATACCT; SEQ ID NO.3:AGTGCGGCCTAACTATACCTT。 the invention has the beneficial effects that: according to GUS staining results, the transgenic lines (PagV Q5Pro-OE1 and 3) over-expressing the poplar promoter PagVQ Pro can obviously enhance GUS staining activity under the condition of salt induction, so that the fact that the poplar promoter Pag VQ5Pro is subjected to salt induction expression is proved, and a theoretical basis is laid for application of the transgenic lines in stress-tolerant breeding. Drawings FIG. 1 is an agarose electrophoresis pattern (WT: control; poplar promoter transgenic lines PagVQ Pro-OE1, 3); FIG. 2 is a graph showing the results of salt induction staining of leaves of control group WT and poplar promoter transgenic lines PagVQ Pro-OE1, 3 in a poplar seedling salt induction experiment. Detailed Description The present application will be described in further detail with reference to the accompanying drawings, wherein it is to be understood that the following detailed description is for the purpose of further illustrating the application only and is not to be construed as limiting the scope of the application, as various insubstantial modifications and adaptations of the application to those skilled in the art can be made in light of the foregoing disclosure. 1. Material The methods used in this example are conventional methods known to those skilled in the art unless otherwise indicated, and the materials such as reagents used are commercially available products unless otherwise indicated. 2. Method of 2.1 Cloning of the promoter sequence Cloning the n