CN-121109172-B - Bacillus dinitrogen-eating plant capable of degrading benzene series and application thereof
Abstract
The invention provides a plant bacillus dinitrogen capable of degrading benzene series and application thereof. In particular to a plant bacillus dinitrogen eating (Phytobacter diazotrophicus) strain which has a preservation number of CGMCC No.32883. The strain of plant bacillus dinitrogen eating (Phytobacter diazotrophicus) of the present invention is designated DPB548, which can be used for degradation of benzene-based compounds in water or air.
Inventors
- DAI LEI
- WANG LANXIANG
Assignees
- 杭州微新生物科技有限公司
Dates
- Publication Date
- 20260505
- Application Date
- 20250108
Claims (13)
- 1. A plant bacillus dinitrogen (Phytobacter diazotrophicus) with preservation number CGMCC No. 32883.
- 2. A bacterial preparation comprising the plant bacillus diazotrophicus of claim 1.
- 3. The bacterial formulation of claim 2, which is a liquid or solid formulation of viable bacteria.
- 4. The bacterial formulation of claim 2, comprising one or more of the following formulation forms: A floral nutrition soil comprising the plant bacillus diazotrophicus of claim 1; A bacterial liquid for watering green plants in a room comprising the plant bacillus diazotrophicus of claim 1; A carrier filler for a purification apparatus comprising the plant bacillus dinitrogen eating device of claim 1; a liquid formulation comprising the plant bacillus diazotrophicus of claim 1.
- 5. The bacterial formulation of claim 4, wherein the carrier filler is one or more of a nano-carrier filler, an agar gel.
- 6. The bacterial formulation of claim 4, wherein the liquid formulation is a spray.
- 7. A method of culturing the plant bacillus diazotrophicus of claim 1, the method comprising: inoculating the plant bacillus dinitrogen feeding device of claim 1 into a culture medium for fermentation culture.
- 8. A method of preparing a lyophilized powder comprising the plant bacillus diazotrophicus of claim 1, the method comprising: The plant bacillus diazotrophicus of claim 1 is subjected to fermentation and then is subjected to freeze drying by adding a protective agent to prepare freeze-dried powder.
- 9. Use of the plant bacillus diazotrophicus of claim 1, the bacterial formulation of any one of claims 2-6, for the preparation of a formulation for degrading benzene-based compounds; wherein the benzene series is selected from one or more of benzene, toluene, ethylbenzene and xylene.
- 10. A method of degrading benzene-based material, the method comprising: Contacting the plant bacillus diazotrophicus of claim 1, the bacterial formulation of any one of claims 2-6, with a sample or environment of a benzene-series to be degraded; wherein the benzene series is selected from one or more of benzene, toluene, ethylbenzene and xylene.
- 11. The method of claim 10, wherein the sample of benzene-series to be degraded is a body of water, the method comprising throwing the plant bacillus dinitrogen-eating bacteria of claim 1, the bacterial formulation of any one of claims 2-6, into the body of water.
- 12. The method according to claim 10, wherein the environment in which the benzene series is degraded is an indoor air environment, the method comprises preparing the plant bacillus dinitrogen eating bacteria according to claim 1, the bacterial preparation according to any one of claims 2-6 into bacterial liquid, and then pouring the bacterial liquid into soil, spraying the bacterial liquid onto the surfaces of indoor objects, or combining the bacterial liquid with a small aerodynamic device, or placing the flower nutrient soil containing the plant bacillus dinitrogen eating bacteria according to claim 1 into the environment in which the benzene series is degraded.
- 13. The method of claim 12 wherein the floral nutrient soil is seeded with a plant.
Description
Bacillus dinitrogen-eating plant capable of degrading benzene series and application thereof Technical Field The invention relates to a plant bacillus and application thereof, in particular to a dinitrogen-eating plant bacillus (Phytobacter diazotrophicus) strain capable of degrading benzene series and application thereof in degrading the benzene series. Background The indoor benzene series mainly comprises volatile organic compounds such as benzene, toluene, ethylbenzene, xylene and the like, and widely exists in finishing materials such as paint, coating, adhesive, cleaning agent, carpet and the like, and the release period can be as long as several years, thereby greatly threatening the health of residents. Benzene-based contamination has various hazards to human health. Inhalation of high concentrations of benzene compounds in the short term can cause acute poisoning manifested by dizziness, headache, nausea, emesis, debilitation, etc., and in severe cases, loss of consciousness. Benzene is classified by the world health organization as a class 1 carcinogen because of its dangers. Prolonged exposure to low concentrations of benzene can cause damage to the hematopoietic system, potentially leading to leukopenia, aplastic anemia, and even increased risk of leukemia. Long-term inhalation of toluene and xylene can cause damage to the nervous system, resulting in symptoms such as reduced memory, inattention, and mood swings, and can also affect liver and kidney function. Benzene series pose a greater health threat to children and pregnant women, possibly leading to fetal dysplasia, abortion or neonatal health problems. At present, the methods for treating the indoor benzene series pollution are various and mainly comprise ventilation, activated carbon adsorption, air purifier, plant adsorption, physical and chemical treatment and other means. These methods have advantages and disadvantages and generally require comprehensive use for best results. Ventilation is the simplest and least costly method. Diluting and exhausting free benzene series in the room by increasing air circulation. However, the benzene removal method has limited effect, can only temporarily reduce the concentration of benzene compounds in a room, and is limited by climate conditions. The activated carbon has good performance of adsorbing harmful VOC, but has limited adsorption capacity, can be usually maintained for a period of time, needs to be replaced or regenerated frequently, is used for adsorbing benzene series, is passive and can not treat a benzene series release source which is slowly released for a long time, and particularly has poor treatment effect on high-concentration benzene series, and is more suitable for treating benzene series in a small space. The photocatalytic benzene removal system is to decompose the benzene system through a photocatalyst under the action of ultraviolet light or visible light, but the method relies on a light source, has a limited catalyst life and is only suitable for treating the benzene system with low concentration. Chemical methods for removing benzene series usually decompose benzene series by spraying chemical reagents (catalysts or oxidants), which may cause secondary pollution due to improper use, and are not suitable for long-term and sustained-release pollution sources. The use of air purifier is a common treatment means, and modern air purifier is equipped with various filter screens and purification techniques, such as HEPA filter screens, active carbon filter screens, etc., and can effectively remove benzene series in air, but the air purifier has the disadvantages of high cost, limited effect, limited purification range, etc. The plasma purifying technology is to decompose benzene series by generating plasma through a high-voltage electric field, and the method can generate harmful substances such as ozone, has high cost, maintenance cost and operation cost and is not suitable for removing benzene series for a long time. There is a need to develop new and efficient air purification schemes. Disclosure of Invention The inventor discovers that the plant bacillus dinitrogen eating (Phytobacter diazotrophicus) can degrade benzene series in the research, can be used for preparing microbial preparations and is used for degrading the benzene series in water or air. The strain is named DPB548, and is preserved in China general microbiological culture Collection center (CGMCC) (preservation unit address: north Star, west way No. 1, 3, institute of microbiology, academy of sciences of China, post code: 100101), preservation date: 2024, month 12, 02, preservation number: CGMCC No.32883, and classification name: bacillus natto (Phytobacter diazotrophicus). The 16S rRNA sequence of DPB548 of Bacillus dinitrogen eating (Phytobacter diazotrophicus) (SEQ ID NO. 1): TTGAAGAGTTTGATCATGGCTCAGATTGAACGCTGGCGGCAGGCCTAACACATGCAAGTCGAACGGTAGCACAGAGAGCTTGCTCTCGGGTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCCGATG