CN-121154667-B - Application of DNAzyme in preparation of medicine for treating heat-radiating diseases

Abstract

The invention belongs to the technical field of heat injection treatment, and particularly discloses application of DNAzyme in preparation of a medicine for treating heat injection, wherein the DNAzyme is DNAzyme for targeted regulation and control of ZBP1 protein expression. Also discloses a medicine for preventing and treating the heat-radiating diseases. The invention has important value for preventing and treating the heat-radiating disease fundamentally. The invention fully verifies the remarkable efficacy of DNAzyme_SEQ_1 in the prevention and treatment of the heat-radiating diseases through a systematic experiment. DNAzyme_SEQ_1 delivered by the TPNs carrier shows obvious liver and lung targeting in mice, the fluorescence intensity is obviously higher than that of other organs, and the medicine is ensured to precisely act on the key injury part of the heat-radiating disease.

Inventors

• YAN MIAO
• XIAO MINGXUAN
• XI YANG
• GONG HUI
• ZHANG BIKUI
• LI YAPEI
• Qin Weixiao

Assignees

• 中南大学湘雅二医院

Dates

Publication Date

20260512

Application Date

20250918

Claims (5)

1. 1. The application of DNAzyme in preparing a medicine for treating the thermal jet disease is characterized in that the DNAzyme is DNAzyme for targeted regulation and control of ZBP1 protein expression, and the DNAzyme is DNAzyme_SEQ_1; The dnazyme_seq_1 sequence is: GGGACTCTTGTGTGAAAGCTGGCCGAGCCTCCAGAATGAGCTATG。
2. 2. A medicament for preventing and treating a heat shock disease, characterized in that the medicament comprises DNAzyme, which is dnazyme_seq_1; The dnazyme_seq_1 sequence is: GGGACTCTTGTGTGAAAGCTGGCCGAGCCTCCAGAATGAGCTATG。
3. 3. The medicament for preventing and treating thermal jet disease according to claim 2, further comprising a delivery vehicle for targeted delivery of DNAzyme.
4. 4. A medicament for the prevention and treatment of thermal jet diseases according to claim 3, wherein the delivery vehicle is TPNs.
5. 5. The drug for preventing and treating heat shock according to claim 2, wherein the drug is an oral preparation and/or an injection preparation.

Description

Application of DNAzyme in preparation of medicine for treating heat-radiating diseases Technical Field The invention belongs to the technical field of heat-radiating disease treatment, and particularly relates to an application of DNAzyme in preparation of a medicine for treating heat-radiating disease. Background Thermal jet disease is a fatal emergency caused by exposure to high temperature and high humidity environments and is characterized by a sharp rise in core body temperature (> 40 ℃) and central nervous system dysfunction. Its core pathology consists in a high temperature triggered systemic inflammatory response and eventually mixed programmed cell death leading to multiple organ failure and even death (ubiquity, PANoptosis). Research shows that the activation of Z-DNA binding protein 1 (ZBP 1) is a key link for driving the occurrence of ubiquity in heat-radiating diseases, especially in target organs such as liver, lung and the like. The expression level of the key driver ZBP1 is extremely low in early stage of the heat-shock disease, and is significantly up-regulated by HSF1 only after a long period of exposure at high temperature (12 hours), and then triggers fatal PANoptosis (mixed programmed cell death). The traditional small molecule inhibitors targeting ZBP1 cannot effectively function in a critical early treatment window period due to lack of enough binding targets, so that PANoptosis is difficult to prevent from happening and multiple organ dysfunction. However, the lack of an accurate means for effectively interfering the core pathway of ZBP 1-ubiquity in early disease stage seriously hampers the development of specific drugs. Current clinical treatments are highly dependent on rapid physical cooling (e.g., cold water soaking, evaporative cooling, ice blanket wrapping). Although this is the key to reduce mortality, its effect is limited to cooling, and belongs to passive intervention, and the core mechanism of apoptosis, which can not inhibit ZBP1 expression and its driving, is not targeted. Even if body temperature drops, initiated ubiquity can still cause organ damage. Physical cooling is completely preventive and implementation depends on specific equipment. In terms of drug treatment, no specific chemical or biological drugs targeting the ZBP 1-pan-apoptotic core pathway have been marketed worldwide. Although the traditional Chinese medicine composition or the active monomer is used for exploring the heat-radiating disease, the general action mechanism is wide and unknown, the specific and efficient targeted intervention capability for the ZBP 1-pan-apoptosis pathway is lacking, and the accurate regulation and control of specific genes in key organs are difficult to realize. A key mechanism obstacle is the spatiotemporal nature of ZBP1 expression, the very low basal levels of ZBP1 expression in healthy tissue. Following heat stress, there is a delay in the expression of ZBP1, which subsequently triggers ubiquity. This delay makes conventional small molecule inhibitors difficult to validate during the critical early therapeutic window (hours after heat exposure) due to the lack of adequate target protein binding. In conclusion, the existing hot spot disease prevention and treatment technology has core defects and blank such as lack of specific drugs for targeting core mechanisms, incapability of solving early treatment window period failure caused by ZBP1 delayed expression, lack of effective prevention means, lack of targeting accurate treatment on key organs such as liver, lung and the like. Thus, there is a need to develop strategies that effectively inhibit ZBP1 expression during its up-regulation. Disclosure of Invention The invention aims to provide an application of DNAzyme in preparing a medicine for treating heat-radiating diseases, and aims to solve the problems that the existing heat-radiating disease control technology provided in the background art lacks a specific medicine for targeting a core mechanism, cannot solve early treatment window period failure caused by ZBP1 delayed expression, lacks an effective prevention means, lacks targeting accurate treatment on key organs such as liver, lung and the like, and the like. In order to achieve the aim, the invention provides an application of DNAzyme in preparing a medicine for treating the thermal jet disease, wherein the DNAzyme is a DNAzyme for targeted regulation and control of ZBP1 protein expression. In a specific embodiment, the DNAzyme comprises at least one of DNAzyme_SEQ_1、DNAzyme_SEQ_2、DNAzyme_SEQ_3、DNAzyme_SEQ_4、DNAzyme_SEQ_5、DNAzyme_SEQ_6、DNAzyme_SEQ_7、DNAzyme_SEQ_8; The dnazyme_seq_1 sequence is: GGGACTCTTGTGTGAAAGCTGGCCGAGCCTCCAGAATGAGCTATG; the dnazyme_seq_2 sequence is: ACGTGAGTGGTAGATAAGCTGGCCGAGCCTTCCACGTCTGTCCGT; the dnazyme_seq_3 sequence is: TATGTCTTGGCCTTCAAGCTGGCCGAGCCTGACGTGAGTGGTAGA; the dnazyme_seq_4 sequence is: GAGCTATGTCTTGGCAAGCTGGCCGAGCCTTCCTGAGGTGAGTG; the dnazyme_seq_5 sequence is: CAGAATGAGC