CN-121380016-B - Transferase and production method of carnosine by green enzymatic method

Abstract

The application provides a transferase and a production method of carnosine by a green enzymatic method. The high-activity mutants of DmpA-2 and DmpA-6 are obtained by carrying out single-point or double-point mutation on the wild DmpA enzyme at the 86 th (E86V) and the 259 th (D259A), so that the catalytic efficiency of the beta-amino acid ester acyltransferase is remarkably improved. The method takes beta-alanine and L-histidine as substrates, utilizes recombinant bacteria to express mutant enzyme, catalyzes and synthesizes carnosine under mild conditions, and the concentration of the product is up to 5.36g/L which is 3.53 times that of a wild type, and has the advantages of green reaction condition, high product purity and the like, and is suitable for industrial production.

Inventors

• LIU XIAOXI
• ZHANG DONGZHU
• ZHANG HONGBIN
• HU XUEQIN

Assignees

• 安徽华恒生物科技股份有限公司
• 合肥工业大学

Dates

Publication Date

20260505

Application Date

20251223

Claims (1)

1. 1. The transferase is a mutant obtained by site-directed modification of a wild type DmpA, wherein the mutant is DmpA-2 mutant and DmpA-6 mutant, the amino acid sequence of the wild type DmpA is shown as SEQ ID NO.1, the DmpA-2 mutant is obtained by mutating 86 th glutamic acid of DmpA sequence into valine, the DmpA-6 mutant is obtained by mutating 86 th glutamic acid of DmpA sequence into valine and 259 th aspartic acid of DmpA sequence into alanine, the amino acid sequence of the DmpA-2 mutant is shown as SEQ ID NO.2, the corresponding nucleotide sequence is shown as SEQ ID NO.10, the amino acid sequence of the DmpA-6 mutant is shown as SEQ ID NO.3, and the corresponding nucleotide sequence is shown as SEQ ID NO. 11.

Description

Transferase and production method of carnosine by green enzymatic method Technical Field The application belongs to the field of synthetic biology, and particularly relates to a production method of transferase and green enzymatic carnosine. Background L-carnosine (beta-alanyl-L-histidine) is a naturally occurring dipeptide, is formed by combining beta-alanine and L-histidine through peptide bonds, has various biological activities such as antioxidation, anti-aging, anti-fatigue, immunoregulation and the like, and has wide application prospects in the fields of medicines, foods, cosmetics and the like. It is widely existed in important tissues such as muscle, brain and heart of human body, and has important function for maintaining normal physiological function of organism. The L-carnosine can be used for treating various diseases such as hypertension, heart disease, senile cataract, ulcer and the like, has auxiliary treatment effects on resisting tumors, promoting wound healing and the like, can be used as a natural antioxidant and a food additive in the food field, prolongs the quality guarantee period of food, improves the quality of food, and can delay skin aging and reduce wrinkle generation in the cosmetic field. At present, the production method of L-carnosine mainly comprises a chemical synthesis method and a biological synthesis method. The chemical synthesis method has a plurality of defects, such as complicated synthesis steps, complex protection and deprotection of active groups of a substrate, harsh reaction conditions, high temperature, high pressure, strong acid or alkali and the like, so that the yield is low, the cost is high, the pollution is large, and the purity of the product is difficult to ensure. The biological synthesis method has obvious advantages, mild reaction conditions, is usually carried out at normal temperature, normal pressure and in water phase, accords with the green chemistry principle, and has high optical purity. The enzymatic synthesis is an important approach for biosynthesis, but has some problems in the prior art, such as activation of carboxyl groups of beta-alanine or amino groups of L-histidine in the L-carnosine synthesis reaction catalyzed by aminopeptidase, complex steps, environmental pollution and cost rise, and the reverse hydrolysis reaction catalyzed by carnosine hydrolase does not need to activate a substrate, but the reported beta-amino acid ester acyltransferase has few varieties and low activity, so that the reaction time is long, the product concentration is low, and the industrial requirement is difficult to meet. Disclosure of Invention Aiming at the defects of few varieties and low product concentration of beta-amino acid ester acyl transferase in the prior art, the application provides a production method of transferase and green enzymatic carnosine, and the mutant obtained by site-directed transformation of wild DmpA improves the activity of the beta-amino acid ester acyl transferase and the concentration of the product L-carnosine. The application provides transferase, which is a mutant obtained by site-directed modification of a wild DmpA, wherein the mutant is DmpA-2 mutant and DmpA-6 mutant. Preferably, the wild type DmpA is derived from Escherichia coli, wherein the Escherichia coli is stored in China general microbiological culture Collection center (China Committee for culture Collection of microorganisms) and has a storage date of 2024, month 4 and 28, and is classified and named as Escherichia coli ESCHERICHIA COLI, and registration number of CGMCC No.30472. Preferably, the amino acid sequence of the wild DmpA is shown as SEQ ID NO.1, and the nucleotide sequence is shown as SEQ ID NO. 9: SEQ ID NO.1: MRVQLSPEQVPRRMRIRELLPDLDLGAYPPGPLNSITDVPGVHVHTQEIFGAQGAINTGVTCIVPRPNWSTNACYAGVFRFNGSGELTGAHLIEETGLLCSPIVLTGTFNIGAAHQGIYQYAVKHLGTNKDGQLEWLMLPVVGETFDGYLHDCTSFAVAPAHIVHGLESVVAGEPVREGNVGGGVGMVCHGLKGGTGSSSRQVLGTYTVAALVQANYGQLRDLRIAGVPVGKILTEDAASDPSRQGMYEEVAQAKAEKDGSIIVVLATDAPLHPAQLQRVAKRATVGLARVGGQGHNLSGDIFLAFSTGNEIPVNQHKRPASVARTIDVLDDSALNTLFEATADAVEEAIYNALCMAESLQGFQGHTIEALPLARLKEIMRQYQRV. SEQ ID NO.9: ATGCGCGTCCAGCTATCCCCCGAGCAAGTACCGCGGCGAATGCGCATCCGCGAACTTCTTCCCGACCTCGACCTGGGAGCCTACCCCCCAGGTCCGCTAAATTCCATCACCGACGTGCCTGGCGTGCACGTTCACACCCAAGAGATATTCGGTGCCCAAGGCGCCATCAATACCGGCGTGACCTGCATCGTTCCCCGCCCGAACTGGTCCACCAATGCTTGTTACGCCGGGGTCTTCCGTTTTAACGGCTCGGGAGAGCTAACGGGCGCACATCTGATAGAAGAGACGGGGCTTCTCTGCTCCCCTATTGTTCTCACTGGAACATTTAATATTGGGGCCGCCCACCAAGGGATCTATCAGTATGCCGTCAAACACCTGGGGACTAACAAGGATGGTCAGTTGGAGTGGCTTATGTTGCCGGTCGTGGGTGAGACGTTCGATGGGTATTTGCATGACTGTACATCGTTCGCTGTGGCTCCTGCGCACATCGTGCACGGTCTGGAGAGTGTGGTGGCTGGGGAGCCAGTTCGAGAGGGTAATGTGGGCGGTGGCGTGGGCATGGTTTGCCATGGACTGAAAGGGGGTACCGGGAGCAGCAGTCGCCAGGTTCTCGGAACCTACACGGTCGCAGCGTTGGTCCAGGCTAATTACGGGCAATTAAGAGATCTCCGCATTGCAGGGGTCCCTGTTGGGAAAATACTAACTGAAGACGCTGCGAGCGACCCCTCAAGACAGGGGATGTATGAGGAGGTCGCACAGGCAAAGGCCGAGAAGGACGGCAGTATAATCGTTGTACTGGCCACAGATGCGCCGCTTCATCCCGCTCAGTTGCAGCGTGTTGCCAAGCGGGCAACCGT