CN-121406825-B - Molecular marker related to peanut salt tolerance and application thereof
Abstract
The invention discloses a molecular marker related to peanut salt tolerance and application thereof, belonging to the technical fields of molecular biology and plant genetic breeding. The molecular marker assisted breeding method of the peanut salt-tolerant variety is established on the basis of screening and obtaining molecular markers related to the peanut salt tolerance, and a new peanut variety with saline-alkali soil planting potential is cultivated. The molecular marker is SNP locus molecular marker linked with peanut salt tolerance, the SNP locus molecular marker is located at 77 position with sequence SEQ ID NO. 1, and the base is G/A. The molecular markers related to the salt tolerance of the peanuts are obtained through screening and are used for screening salt-tolerant parents, so that the salt-tolerant genetic breeding and breeding speed of the peanuts is increased, and the breeding efficiency of salt-tolerant strains and the yield of saline-alkali soil are improved.
Inventors
- ZHANG XIURONG
- XUE QIQIN
- LI DA
- ZHANG AIAI
- LIU YONGGUANG
- SU YANZHU
- Han Tongyao
Assignees
- 潍坊科技学院
Dates
- Publication Date
- 20260508
- Application Date
- 20251230
Claims (3)
- 1. A method for screening salt-tolerant peanut seedlings is characterized by screening individuals with GG homozygote genotype in SNP molecular markers linked with peanut salt tolerance, wherein the sequence of the SNP molecular markers is shown as SEQ ID NO. 1, and G/A mutation exists at 77 th base.
- 2. The method of claim 1, wherein the nucleic acid sample from the individual is amplified by PCR primers and the amplified product is typed or sequenced, wherein the upstream primer has the sequence of SEQ ID NO.2 and the downstream primer has the sequence of SEQ ID NO. 3.
- 3. A method for cultivating salt-tolerant peanut seedlings, wherein the seedlings screened by the method of claim 1 are used as F0 generation for cultivation.
Description
Molecular marker related to peanut salt tolerance and application thereof Technical Field The invention belongs to the technical fields of molecular biology and plant genetic breeding, and particularly relates to a molecular marker related to salt tolerance of peanuts and application thereof. Background Peanuts (Arachis hypogaea L.) are globally important oil crops, protein sources and cash crops, and play an irreplaceable role in ensuring edible oil safety and promoting farmer income. However, the increasingly severe global problem of soil salinization severely restricts peanut yield and expansion of the planting area. Peanuts belong to medium salt tolerance crops, and salt stress can obviously inhibit seed germination, seedling growth and pod development of the peanuts, and finally greatly reduce yield. Therefore, the cultivation and popularization of the new variety of the salt-tolerant peanuts is a fundamental way for coping with the salinization challenges and guaranteeing the sustainable development of the industry. Traditional peanut salt tolerance breeding is mainly dependent on field phenotype selection. The method needs to observe and evaluate a large amount of breeding materials in multiple growth periods in a natural saline-alkali soil or artificially created salt stress environment, and salt-tolerant single plants are screened according to survival, growth vigor and final yield of plants. However, the method has obvious limitations that firstly, the heterogeneity of field salinity distribution and changeable climatic environment lead to poor repeatability and low accuracy of phenotype identification results, secondly, breeders must wait for plants to grow to a critical period and even complete the whole growth period to perform effective evaluation, so that the breeding period is extremely long and usually needs eight to ten years, and finally, as the salt tolerance is a complex quantitative character controlled by multiple genes, the traditional method is difficult to accurately identify individuals with excellent salt tolerance genes and high-yield high-quality agronomic characters in early stage, and the selection efficiency is low. The molecular marker assisted selection technology provides a powerful tool for breaking through the traditional breeding bottleneck. The technology can realize accurate and rapid genotype selection in a seedling stage and even a seed stage by detecting the DNA molecular marker closely linked with the target trait, is not interfered by environment, and can greatly shorten the breeding period. Although this technology has been used in crops such as rice and maize, development in the field of peanut salt tolerance breeding has been relatively delayed. The main dilemma facing the current is that the disclosed molecular markers that are significantly linked to peanut salt tolerance and stably expressed in different genetic contexts are very scarce. Many candidate regions or markers discovered by prior studies have not been converted into practical tools that facilitate routine laboratory detection, are inexpensive, and are validated by large-scale breeding materials. The lack of the high-efficiency molecular marker directly limits the large-scale application of the technology in the genetic improvement of peanut salt tolerance. Therefore, the current peanut breeding field is in urgent need of a molecular marker which is fully verified, closely related to salt tolerance and simple and reliable in detection, so that a high-efficiency molecular marker auxiliary selection system is established, and the breeding process of new variety of salt-tolerant peanut is accelerated. Disclosure of Invention The invention aims to provide a molecular marker related to peanut salt tolerance and application thereof, namely a molecular marker assisted breeding method of peanut salt tolerance varieties is established on the basis of screening and obtaining the molecular marker related to peanut salt tolerance, and new peanut varieties with saline-alkali soil planting potential are cultivated. The invention firstly provides an SNP locus molecular marker linked with peanut salt tolerance, wherein the SNP locus molecular marker is positioned at 77 th site of SEQ ID NO. 1, and the base is G/A; GCGGTTCTAGTTGGGTTGGAAAGCTAACATCCGGGGCTTCGAAATGATATAAGATTTTCTATGGTTGAACCACGCAGGGTGACGCGTACGCGCATAGTACGCGGACGCGCCGTTGCTGCCACCTGGTTCACTTAAAGCAAAACATGGCCAGCGAAT(SEQ ID NO:1). The primer pair for detecting the SNP locus is used, and the sequence information is as follows: forward primer 5'-GCGGTTCTAGTTGGGTTGGA-3' (SEQ ID NO: 2); Reverse primer 5'-TAAGTGAACCAGGTGGCAGC-3' (SEQ ID NO: 3); In a further aspect, the invention provides an application of the molecular marker in screening peanut individuals with salt tolerance; the invention also provides a method for screening salt-tolerant peanut seedlings, which is to screen individuals with the SNP locus of GG homozygosity; The method is that after the nucleic a