Search

CN-121592784-B - Molecular marker combination related to cockscomb height character, detection reagent and application thereof

CN121592784BCN 121592784 BCN121592784 BCN 121592784BCN-121592784-B

Abstract

The invention discloses a molecular marker combination related to cockscomb height characters, a detection reagent and application thereof, and belongs to the technical field of molecular genetics. According to the invention, 10 SNP loci which are obviously associated with the cockscomb opening height and 130-day-old cockscomb height are identified in the intron of the CTCF gene for the first time, and based on the SNP loci, the invention designs a molecular marker combination and a detection reagent thereof which are related to cockscomb height characters, can be used for early screening of laying hens with high cockscomb height, and has important significance for breeding and breeding of sexual precocity high-quality laying hens.

Inventors

  • SUN YI
  • Li Zhaogan
  • KANG LI
  • ZHANG HONGRUI

Assignees

  • 山东农业大学

Dates

Publication Date
20260512
Application Date
20260128

Claims (3)

  1. 1. The application of the molecular marker combination related to the cockscomb height character in breeding Langya hen with different cockscombs height is characterized in that the molecular marker combination related to the cockscomb height character comprises a first molecular marker and a second molecular marker; the nucleotide sequence of the first molecular marker is shown as SEQ ID NO.1, and the nucleotide sequence of the second molecular marker is shown as SEQ ID NO. 2; the first molecular marker comprises an SNP1 site, an SNP2 site, an SNP3 site, an SNP4 site and an SNP5 site, wherein the 54 th base of the sequence shown in SEQ ID NO.1 is the SNP1 site, the base thereof is C or T, the 303 th base is the SNP2 site, the base thereof is C or T, the 307 st base is the SNP3 site, the base thereof is G or A, the 401 st base is the SNP4 site, the base thereof is T or C, the 700 th base is the SNP5 site, and the base thereof is G or A; The second molecular marker comprises an SNP6 site, an SNP7 site, an SNP8 site, an SNP9 site and an SNP10 site, wherein the 87 th base of the sequence shown in SEQ ID NO.2 is the SNP6 site, the base thereof is A or T, the 104 th base is the SNP7 site, the base thereof is C or T, the 112 th base is the SNP8 site, the base thereof is A or C, the 120 th base is the SNP9 site, the base thereof is G or T, the 128 th base is the SNP10 site, and the base thereof is C or A; The 54 th base of the sequence shown in SEQ ID NO.1 is TT genotype, the 303 th base is TT genotype, the 307 th base is AA genotype, the 401 st base is CC genotype, the 700 th base is AA genotype, the 87 th base of the sequence shown in SEQ ID NO.2 is TT genotype, the 104 th base is TT genotype, the 112 th base is CC genotype, the 120 th base is TT genotype, the 128 th base is AA genotype, and the high cockscomb height character is identified; The cockscomb height is high in the beginning of birth or 130 days old.
  2. 2. The application of the detection reagent in the genetic breeding of chickens is characterized in that the genetic breeding of chickens is Langya hen breeding with high cockscomb height character; The detection reagent comprises a primer pair A for detecting a first molecular marker of the molecular marker combination of claim 1 and a primer pair B for detecting a second molecular marker; the nucleotide sequences of the primer pair A are respectively shown as SEQ ID NO.3 and SEQ ID NO.4, and the nucleotide sequences of the primer pair B are respectively shown as SEQ ID NO.5 and SEQ ID NO. 6; the method for breeding the laying hens with high cockscomb height characters comprises the following steps: Taking genomic DNA of Langya hen to be detected as a template, carrying out PCR amplification by using a primer pair A shown in SEQ ID NO.3 and SEQ ID NO.4 to obtain an amplification product A, carrying out PCR amplification by using a primer pair B shown in SEQ ID NO.5 and SEQ ID NO.6 to obtain an amplification product B; if the sequencing result of the amplified product A corresponds to the 54 th base of the sequence shown in SEQ ID NO.1 to be TT genotype, the 303 th base to be TT genotype, the 307 th base to be AA genotype, the 401 st base to be CC genotype, the 700 th base to be AA genotype, the sequencing result of the amplified product B corresponds to the 87 th base of the sequence shown in SEQ ID NO.2 to be TT genotype, the 104 th base to be TT genotype, the 112 th base to be CC genotype, the 120 th base to be TT genotype and the 128 th base to be AA genotype, the high cockscomb height property is identified; The cockscomb height is high in the beginning of birth or 130 days old.
  3. 3. The use according to claim 2, wherein the detection reagent is a PCR sequencing kit or a KASP typing kit.

Description

Molecular marker combination related to cockscomb height character, detection reagent and application thereof Technical Field The invention relates to the technical field of molecular genetics, in particular to a molecular marker combination related to cockscomb height characters, and a detection reagent and application thereof. Background Precocity is one of important breeding traits for breeding high-quality chickens. In actual breeding work, the direct selection process of the day-old of parturition is tedious, the duration is long, and how to measure sexual maturity through the early growth characters of chicken flocks is one of the continuously explored contents of breeding workers. The cockscomb height character is taken as an important phenotypic characteristic of the chicken flock, and has various practical values for production practice. Crown height is often positively correlated with sexual maturity, and well developed high crowns often indicate a stronger reproductive capacity. When high crown individuals are bred, the genetic progress of the weight can be indirectly promoted, the appearance standard and the growth speed are both considered, the problem of weight reduction caused by premature breeding is avoided, and the breeding income is ensured. At present, candidate genes and molecular markers related to the cockscomb height traits are relatively less in research, so that a new molecular marker related to the cockscomb height traits is searched, and the method has important significance for breeding high-quality chickens. Disclosure of Invention Aiming at the prior art, the invention aims to provide a molecular marker combination related to cockscomb height characters, and a detection reagent and application thereof. In order to achieve the above purpose, the invention adopts the following technical scheme: In a first aspect of the invention, a combination of molecular markers associated with cockscomb height traits is provided, comprising a first molecular marker and a second molecular marker; The nucleotide sequence of the first molecular marker is shown as SEQ ID NO.1, and comprises an SNP1 site, an SNP2 site, an SNP3 site, an SNP4 site and an SNP5 site, wherein the 54 th base of the sequence shown as SEQ ID NO.1 is an SNP1 site, the base of the 54 th base is C or T, the 303 rd base of the sequence shown as SEQ ID NO.1 is an SNP2 site, the base of the 303 rd base is C or T, the 307 st base of the sequence shown as SEQ ID NO.1 is an SNP3 site, the base of the 307 st base is G or A, the 401 st base of the sequence shown as SEQ ID NO.1 is an SNP4 site, the base of the SNP4 site is T or C, the 700 th base of the sequence shown as SEQ ID NO.1 is an SNP5 site, and the base of the SNP is G or A; The nucleotide sequence of the second molecular marker is shown as SEQ ID NO.2, and comprises an SNP6 site, an SNP7 site, an SNP8 site, an SNP9 site and an SNP10 site, wherein the 87 th base of the sequence shown as SEQ ID NO.2 is an SNP6 site, the base of the SNP6 site is A or T, the 104 th base of the sequence shown as SEQ ID NO.2 is an SNP7 site, the base of the SNP7 site is C or T, the 112 th base of the sequence shown as SEQ ID NO.2 is an SNP8 site, the base of the SNP8 site is A or C, the 120 th base of the sequence shown as SEQ ID NO.2 is an SNP9 site, the base of the SNP9 site is G or T, the 128 th base of the sequence shown as SEQ ID NO.2 is an SNP10 site, and the base of the SNP is C or A. The first molecularly marked nucleotide is specifically as follows: ATTAAAGCTGTAATAGATGTTTGTCAAGTAGTAGGTTTGACTTTATTTTCTTTC/T(SNP1)AGTGTTTTCAGTGCCAGTGTTCTGGATGGCAAGAAGGAAATGAGAGCAGCTGGAGATGGTTGTAGCACTCGTAACCAGTGGATATGGGATTTAATGCAGCAGGCAAATGAAAGCTCTGTTTCCAGCATGAGAAAATTCCTTGATAAACCAAAATTCCCAATTTCTCAGGTGTGCCAGACTTCCTACCATCAGCAGGTGTGATAGCTCTATGAAAACAGCCTGTCTCGAGCTGTTCTCATCAAGTAGCAC/T(SNP2)GACG/A(SNP3)TTTGATAGGCTTATCTTCAGTAGAAGAAAAAGTTCCCTCTTTCACCTATTCTTAATTCAACACAACTTTAAGCCTTTGCATGTGTTTTATTTAT/C(SNP4)GATTGGATGCTTAAGCAAATCTGCCCCTATTCATCTTTTACATTTCTCTGAGCAATTAGCAACAAATGGATGAGAGTCTCCTATGAGATTTTAGTCTTTGTGTATGTAATCTGAGCCCTGGTTGAACTCTCAACTCTTTGTACCACTTTCCTTGTATGAGGATTTACTGGGTTCTAGTGCCACACTGTGGAGAACAGGAATTGACATACACTGGAATTGAGAGCATGAGGCTTTGGGAGGAGGTAGCACATGCACCCAGTTCATATTCTGGTTTTGTTGCCTGTGTTTTTCTGTTGATG/A(SNP5)AACCCAGGAAGTGTAGTGATTATGG. note that the nucleotide in the sequence, which is bolded and shaded, is a SNP site, and is represented by "n" in the sequence Listing. The second molecular tagged nucleotide is specifically as follows: ataactgaagtgagttctgagcgtaagaactgaagtcttcgttcttagtcctttttcctcctgaaaaagctttgcagttctcaagcA/T(SNP6)taatgcttcatgtcagC/T(SNP7)tctttgcA/C(SNP8)tgtgacaG/T(SNP9)tatgttaC/A(SNP10)ttttgtgtctctagcgtgtataaccaaagacagactctgatgctactgatctaaacgaagtggaatcctaaagaagctcagtagagagtgaaattatggtagatcttggctgt. note that the nucleotide in the sequence, which is bolded and shaded, is a SNP site, and is represented by "n" in the sequence Listing. In the invention, 10 SNP loci which are obviously associated with cockscomb