CN-121721263-B - Metal nucleic acid frame nano cascade enzyme and preparation method and application thereof
Abstract
The invention relates to the technical field of biosensors, and discloses a metal nucleic acid frame nano-cascade enzyme, a preparation method and application thereof. The preparation method of the nano-cascade enzyme comprises the steps of mixing nucleotide sequences shown in SEQ ID NO.1-10 in an equimolar ratio, carrying out annealing reaction to obtain DNA nano-sheets of a metal template, and carrying out reaction between the DNA nano-sheets and a metal precursor to obtain the metal nucleic acid frame nano-cascade enzyme. The metal nucleic acid frame nano cascading enzyme DNS-Fe has catalase activity, can accurately identify a target object in various interferents after adding corresponding aptamer, has high accuracy, has lactate oxidase, glucose oxidase and sarcosine oxidase activities, has urate oxidase activities, can realize cascading effect by combining the metal nucleic acid frame nano cascading enzyme DNS-Fe with DNS-Ag/Fe, replaces natural catalase to catalyze hydrogen peroxide to generate free radicals and color development substances to generate color development reaction, and is easy to observe.
Inventors
- OUYANG XIANGYUAN
- DU HAOXUAN
- CAO XIAOYANG
- MA JING
- Lei Mengyan
- Yin Yeqi
- YAO LISHAN
- LIU YANTONG
- Hui Minxuan
- YANG YUXUAN
- CHEN LINYAN
Assignees
- 西北大学
Dates
- Publication Date
- 20260512
- Application Date
- 20260224
Claims (6)
- 1. A biosensor for detecting in-vivo metabolites is characterized by comprising a metal nucleic acid frame nano-cascading enzyme and corresponding aptamer of the in-vivo metabolites, wherein the metal nucleic acid frame nano-cascading enzyme is connected with the aptamer of the in-vivo metabolites through an extension chain, the sequence of the extension chain is shown as SEQ ID NO.11-14, and the sequence of the aptamer is shown as SEQ ID NO. 15-21; The preparation method of the metal nucleic acid frame nano-cascade enzyme comprises the following steps: Step 1, preparing a DNA nanosheet, namely mixing nucleotide sequences shown in SEQ ID NO.1-5 and SEQ ID NO.6-10 in an equimolar ratio, and carrying out annealing reaction to obtain the DNA nanosheet of the metal template; step 2, preparing metal nucleic acid frame nano-cascade enzyme, namely reacting the DNA nano-sheet in the step 1 with a metal precursor to obtain the metal nucleic acid frame nano-cascade enzyme; The metal nucleic acid frame nano-cascading enzyme comprises DNS-Pt/Fe, DNS-Fe and DNS-Ag/Fe; DNS-Fe has catalase activity, DNS-Pt/Fe has lactate oxidase, glucose oxidase and sarcosine oxidase activities, and DNS-Ag/Fe has urate oxidase activity; The metal precursor comprises potassium hypochloroplatinate, anhydrous ferric trichloride and silver nitrate.
- 2. The biosensor according to claim 1, wherein in the step 2, the preparation method of DNS-Pt/Fe comprises the steps of taking out and centrifuging DNA nano-sheets of a metal template, transferring the DNA nano-sheets to a new centrifuge tube, adding potassium hypochloroplatinate, anhydrous ferric trichloride and dimethylamine borane, and reacting at 25 ℃ and 400rpm overnight to obtain DNS-Pt/Fe; the preparation method of the DNS-Fe comprises the steps of taking out the DNA nano-sheet of the metal template, centrifuging, transferring to a new centrifuge tube, adding anhydrous ferric trichloride and dimethylamine borane, and reacting at 25 ℃ at 400rpm overnight to obtain the DNS-Fe.
- 3. The biosensor of claim 2, wherein in DNS-Pt/Fe, the concentration of potassium hypochloroplatinate is 9 mmoL/L, the concentration of anhydrous ferric trichloride is 30 mmoL/L, the concentration of dimethylamine borane is 400 mmoL/L, the volume ratio of DNA nanosheets of potassium hypochloroplatinate to anhydrous ferric trichloride to dimethylamine borane is 30 μL of 0.3 μL of 0.15 μL of 0.3 μL; In DNS-Fe, the concentration of anhydrous ferric trichloride is 30 mmoL/L, the concentration of dimethylamine borane is 400 mmoL/L, and the volume ratio of DNA nanosheets to anhydrous ferric trichloride to dimethylamine borane is 30 mu L to 0.15 mu L to 0.3 mu L.
- 4. The biosensor according to claim 1, wherein in the step 2, the preparation method of DNS-Ag/Fe comprises the steps of taking out the DNA nanosheets of the metal templates, centrifuging, transferring to a new centrifuge tube, adding silver nitrate and anhydrous ferric trichloride, reacting for 1h at 4 ℃ and 400rpm, adding sodium borohydride, and continuing the reaction at 4 ℃ and 400rpm overnight to obtain the DNS-Ag/Fe.
- 5. The biosensor of claim 4, wherein the concentration of silver nitrate is 50 mmoL/L, the concentration of anhydrous ferric trichloride is 100 mmoL/L, the concentration of sodium borohydride is 150 mmoL/L, and the volume ratio of DNA nanosheets to silver nitrate to anhydrous ferric trichloride to sodium borohydride is 100. Mu.L to 0.3. Mu.L.
- 6. The biosensor of claim 1, wherein the in vivo metabolite comprises lactic acid, glucose, uric acid, and sarcosine.
Description
Metal nucleic acid frame nano cascade enzyme and preparation method and application thereof Technical Field The invention relates to the technical field of biosensors, in particular to a metal nucleic acid frame nano-cascade enzyme, a preparation method and application thereof. Background When the related technology of the existing biosensor detects in-vivo metabolites, the related technology faces the key problems of insufficient substrate selectivity, poor structural stability, difficult meeting of actual requirements of catalytic activity and the like, and is specifically as follows: 1. The substrate selectivity is insufficient and is easy to be interfered, although the prior art improves the recognition capability of the target object by the aptamer, under the complex environment that a plurality of substances such as glucose, lactic acid, uric acid, sarcosine and the like coexist in a biological sample, the combination specificity of the aptamer and the target object is not completely optimized, the phenomenon of cross recognition is easy to occur, and the accuracy of the detection result is affected. Meanwhile, the cascade catalysis process is easily interfered by inherent intermediates (such as hydrogen peroxide which exists in nature) in a sample, so that a positive deviation occurs in a detection result. The core causes are that a logic regulation mechanism for the characteristic of 'product relay' of cascade reaction is lacking, so that the action paths of a target substrate and an interfering substance are difficult to effectively distinguish, and the accurate identification of the target metabolite cannot be realized. 2. The structure stability is poor and the preparation is limited, the traditional metal nucleic acid nano structure has common assembly defects, the entropy-induced high-dimensional lattice defect rate can reach 70% under the sub1 nanometer period, the DNA single strand is easy to embed into adjacent lattices to damage the structural integrity, the DNA paper folding structure is limited by the length of the phage single strand and the base sequence, the stability of the assembled metal nano structure is weak, the electromagnetic field strength is insufficient, and the long-term effective detection performance is difficult to maintain. The root of the problem is that the dynamics regulation and control difficulty of nucleic acid self-assembly is high, free swing of a DNA chain in a short-period sequence is easy to induce dislocation combination, meanwhile, the interface acting force of metal and nucleic acid is difficult to accurately control, the composite structure is easy to dissociate, and the uniformity and stability regulation and control of the structure are difficult to realize in the preparation process. 3. The conversion is difficult due to insufficient catalytic activity, the catalytic efficiency of the existing artificial cascade nanoenzyme is far lower than that of the natural enzyme, and the detection sensitivity is difficult to meet the clinical and practical application demands. The key reason is that the active site distribution of the metal nano enzyme is unreasonable, the space synergistic effect of the aptamer and the catalytic site is not fully optimized, the cascade catalytic efficiency is limited, the catalytic reaction and signal amplification of the target metabolite cannot be completed efficiently, and the practical conversion and application of the metal nano enzyme in the biosensor are further limited. Disclosure of Invention The invention aims to provide a metal nucleic acid frame nano-cascade enzyme, a preparation method and application thereof, so as to solve the technical problems. In order to achieve the above object, the present invention provides a method for preparing a metal nucleic acid framework nano-cascade enzyme, comprising the steps of: Step 1, preparing a DNA nanosheet, namely mixing nucleotide sequences shown in SEQ ID NO.1-5 and SEQ ID NO.6-10 in an equimolar ratio, and carrying out annealing reaction to obtain the DNA nanosheet of the metal template; SEQ ID NO.1-5, SEQ ID NO.6-10 sequences are as follows: Tile A: A-SC1:GATGGCGAGAGCCTATCGTGATGAACGTACACTGTGAGAATTGACAT(SEQ ID NO.1); A-SC2:CAGACGCTGGTTGATCGCAATATACTACAGGCCAGTTGGGAATGCGG(SEQ ID NO.2); A-ST1:GTAGCGCCGCATTCGGCTCTC(SEQ ID NO.3); A-ST2:TGTAGTATATTCAGTGTACGTTCATCACGATACCAACTGGCC(SEQ ID NO.4); A-ST3:GACTGCATGTCAATTCTCAGCGATCAACCAG(SEQ ID NO.5); Tile B: B-SC1:CGCTACCGTGAACCATAGACTAACTCATACGCTCGACGGACAGCAGC(SEQ ID NO.6); B-SC2:GCAGTCGCGGGACCTGACTTTGTGCATCGAAATCCTCCTGCAACGACT(SEQ ID NO.7); B-ST1:CGTCTGGCTGCTGTGGTCCCGC(SEQ ID NO.8); B-ST2:TGCACAAAGTCACCGTCGAGCGTATGAGTTAGTGGATTTCGA(SEQ ID NO.9); B-ST3:GCCATCAGTCGTTGCAGGACTATGGTTCACG(SEQ ID NO.10); step 2, preparing metal nucleic acid frame nano-cascade enzyme, namely reacting the DNA nano-sheet in the step 1 with a metal precursor to obtain the metal nucleic acid frame nano-cascade enzyme; The metal nucleic acid frame nano-cascading e