Search

CN-121971459-A - Method for synthesizing anthracycline compound for treating chronic myelogenous leukemia by enzymatic method

CN121971459ACN 121971459 ACN121971459 ACN 121971459ACN-121971459-A

Abstract

The invention provides a method for synthesizing an anthracycline compound for treating chronic myelogenous leukemia by an enzymatic method, wherein the two anthracycline compounds are 10-decarboxylated-13-deoxyerythromycin and 10-hydroxy-13-deoxyerythromycin. The invention discovers and proves that 10-decarboxylated-13-deoxyerythromycin and 10-hydroxy-13-deoxyerythromycin have remarkable anti-human chronic myelogenous leukemia cell activity for the first time. The inhibition activity is improved by about 15 and 20 times compared with doxorubicin. The compound has outstanding potential of being developed into a high-efficiency new-generation anthracycline antitumor drug, and provides a new candidate drug selection for leukemia treatment.

Inventors

  • ZHANG WEI
  • Sang Moli

Assignees

  • 中国科学院海洋研究所

Dates

Publication Date
20260505
Application Date
20260112

Claims (10)

  1. 1. Use of 10-decarboxylated-13-deoxo erythromycin or 10-hydroxy-13-deoxo erythromycin of an anthracycline in the preparation of an anti-human chronic myelogenous leukemia cell K-562.
  2. 2. A preparation of anti-human chronic myelogenous leukemia cell K-562, comprising a pharmacologically effective concentration of 10-decarboxylated-13-deoxyerythromycin and/or 10-hydroxy-13-deoxyerythromycin.
  3. The preparation method of 10-decarboxylation-13-deoxyerythromycin is characterized by using wild-type O-methyltransferase DnrK with an amino acid sequence of SEQ ID NO. 1 to catalyze the decarboxylation reaction of substrate 10-carboxylic acid-13-deoxyerythromycin to synthesize 10-decarboxylation-13-deoxyerythromycin.
  4. 4. The method according to claim 3, wherein the wild-type O-methyltransferase DnrK encodes a gene having the nucleotide sequence of SEQ ID NO. 2.
  5. The preparation method of the 10-hydroxy-13-deoxyerythrocin is characterized by comprising the step of catalyzing and synthesizing a catalytic substrate 10-carboxylic acid-13-deoxyerythrocin by using a DnrK mutant with an amino acid sequence of SEQ ID NO. 3 or an amino acid sequence of SEQ ID NO. 5 to perform decarboxylation reaction.
  6. 6. The method according to claim 5, wherein the amino acid sequence is a mutant of SEQ ID NO. 3 and the nucleotide sequence of the encoding gene is SEQ ID NO. 4.
  7. 7. The method according to claim 5, wherein the amino acid sequence is a mutant of SEQ ID NO. 5 and the nucleotide sequence of the encoding gene is SEQ ID NO. 6.
  8. 8. The method of claim 5, wherein the mutant is replaced in whole or in part with an enzyme having the amino acid sequence of SEQ ID NO. 7.
  9. 9. The method of claim 8, wherein the enzyme having the amino acid sequence of SEQ ID NO. 7 encodes a gene having the nucleotide sequence of SEQ ID NO. 8.
  10. 10. A mutant of O-methyltransferase DnrK, which has the amino acid sequence of SEQ ID NO. 3 or SEQ ID NO. 5.

Description

Method for synthesizing anthracycline compound for treating chronic myelogenous leukemia by enzymatic method Technical Field The invention belongs to the technical field of anthracycline synthesis, and in particular relates to a method for synthesizing an anthracycline for treating chronic myelogenous leukemia by an enzymatic method. Background Leukemia is a malignant blood system tumor that severely threatens human health and is characterized by uncontrolled proliferation and accumulation of abnormal leukocytes in bone marrow, inhibiting normal hematopoietic function. Despite the progress of chemotherapy, targeted therapy, hematopoietic stem cell transplantation and other means, some patients still face the problems of drug resistance, high recurrence rate, obvious toxic and side effects of the existing drugs and the like, and the development of novel efficient and low-toxicity therapeutic drugs still remains an urgent challenge in the current clinic. Anthracyclines (such as doxorubicin and daunorubicin) are basic drugs for clinical leukemia chemotherapy, and they exert powerful antitumor effects by a variety of mechanisms such as intercalation into DNA, inhibition of topoisomerase II, and active oxygen production. However, the clinical application benefit of the medicines is greatly limited due to serious dose-dependent toxic and side effects and increasingly prominent drug resistance. Therefore, the development of novel anthracycline derivatives with novel structures and better activity spectrum is a key challenge facing the field of anti-tumor drug development for a long time. In recent years, the biological synthesis way of natural products is modified by adopting rational design and enzyme engineering means, so that the synthesis of natural product analogues with novel structures becomes an important strategy for expanding the pharmaceutical chemistry space. The biological activity and potential therapeutic value of the anthracycline compound are not known, and whether the anthracycline compound can be a drug lead compound with development prospect forms a technical blank to be filled in the field. Disclosure of Invention The invention provides a method for synthesizing an anthracycline compound for treating chronic myelogenous leukemia by an enzymatic method, wherein the two anthracyclines are 10-decarboxylated-13-deoxyerythromycin (shown as a compound 1 or 1 in the specification) and 10-hydroxy-13-deoxyerythromycin (shown as a compound 2 or 2 in the specification). The invention firstly provides application of the anthracycline compound 10-decarboxylation-13-deoxyerythromycin and 10-hydroxy-13-deoxyerythromycin in preparing products of anti-human chronic myelogenous leukemia cells K-562. The invention also provides a preparation for resisting human chronic myelogenous leukemia cell K-562, which comprises 10-decarboxylated-13-deoxyerythromycin and/or 10-hydroxy-13-deoxyerythromycin with pharmacological effective concentration. The invention also provides a preparation method of the 10-decarboxylation-13-deoxyerythromycin and/or 10-hydroxy-13-deoxyerythromycin, which is synthesized by an in vitro enzyme method by using the 10-carboxylic acid-13-deoxyerythromycin as a substrate and using O-methyltransferase DnrK and a mutant DnrK E299A/L thereof or a homologous protein RdmB thereof. Wherein DnrK protease has an amino acid sequence of SEQ ID NO. 1, a nucleotide sequence corresponding to the DnrK protease has a nucleotide sequence of SEQ ID NO. 2, mutant DnrK E299A protease has an amino acid sequence of SEQ ID NO. 3, a nucleotide sequence corresponding to the DnrK E299A protease has a nucleotide sequence of SEQ ID NO. 4, mutant DnrK E299L protease has an amino acid sequence of SEQ ID NO. 5, a nucleotide sequence corresponding to the DnrK E299L protease has a nucleotide sequence of SEQ ID NO. 6, and RdmB protease has an amino acid sequence of SEQ ID NO. 7, and a nucleotide sequence corresponding to the RdmB protease has a nucleotide sequence of SEQ ID NO. 8. As an example of the present invention, the amino acid sequences and corresponding nucleotide sequences of DnrK, dnrK E299A、DnrKE299L and RdmB proteases were as follows: SEQ ID NO:1 MTAEPTVAGRPQQIDALRTLIRLGSLHTPMVVRTAATLRLVDHILAGARTVEALAARTDTRPEALLRLIRHLVAIGLLEEDAPGEFVPTEVGELLADDHPAAQRAWHDLTQAVARADISFTRLPDAIRTGRPTYESIYGKPFYEDLAGRPDLRASFDSLLACDQDVAFDAPAAAYDWTDVRHVLDVGGGKGGFAAAIARRAPHVSATVLEMAGTVDTARSYLKDEGLSDRVDVVEGDFFEPLPRKADTIILSFVLLNWPDHDAVRILTRCAEALEPGGRILIHERDDLHENSFNEQFTELDLRMLVFLGGALRTREKWDGLAASAGLVVEEVRQLPSPTIPYDLSLLVLAPAATGA; SEQ ID NO:2 atgaccgcggaaccaaccgttgcgggtcgtccacaacaaattgatgcgctgcgcaccctgattcgcctgggcagtctgcataccccgatggtggttcgtaccgcggcgaccctgcgtttagttgatcatattctggcgggcgcacgcaccgtggaagcgttagcggcgcgtaccgatacccgtccagaagcgttactgcgcttaattcgccatctggtggcgattggcctgctggaagaagatgcgccgggcgaatttgtgccgaccgaagtgggtgaactgctggcggatgatcatccggcggcgcaacgtgcgtggcatgatttgacccaggcggtggcgcgtgcggatattagctttacccgcctgccggatgcgattcgcaccggccgcccaacctatgaaagcattta