Search

CN-121975689-A - Application of lactobacillus plantarum in preparation of products for relieving hypertension and related complications

CN121975689ACN 121975689 ACN121975689 ACN 121975689ACN-121975689-A

Abstract

The invention relates to the technical field of microbial medicines, and discloses application of lactobacillus plantarum in preparation of products for relieving hypertension and related complications. The lactobacillus plantarum is classified and named Lactiplantibacillus plantarum P517 and is preserved in China Center for Type Culture Collection (CCTCC) NO: M20252435, and the 16S rDNA gene sequence is shown as SEQ ID NO: 1. The lactobacillus plantarum provided by the invention is gram positive bacteria, has high ACE inhibition activity, better antioxidant capacity, better acid and bile salt resistance, and excellent automatic agglutination capacity and antibacterial performance, can relieve hypertension and related complications (intestinal tract, kidney and heart injury) caused by high-salt diet to a certain extent, and can be widely applied to production of foods, health products, medicines and the like.

Inventors

  • XU HENGYI
  • DENG ZIWEI
  • JIA TIANTIAN
  • DAI YIFAN
  • YAN ZIWEN
  • CAI ZHILIN
  • LI XINNA
  • WANG HANGYING
  • YU XINLEI

Assignees

  • 南昌大学

Dates

Publication Date
20260505
Application Date
20260130

Claims (10)

  1. 1. The application of the lactobacillus plantarum in preparing products for relieving hypertension and related complications is characterized in that the lactobacillus plantarum is classified and named Lactiplantibacillus plantarum P517 and is preserved in China Center for Type Culture Collection (CCTCC) NO: M20252435,Lactiplantibacillus plantarum P517, and the 16S rDNA gene sequence of the lactobacillus plantarum is shown as SEQ ID NO: 1.
  2. 2. The use according to claim 1, wherein the hypertension-related complications include one or more of hypertensive heart disease, hypertensive kidney injury, hypertensive liver injury, cerebral arteriosclerosis, hypertensive retinopathy, intestinal mucosa injury, and impaired intestinal barrier function.
  3. 3. The use according to claim 1, wherein the product is a pharmaceutical composition, a health food, a functional food or a dietary supplement.
  4. 4. The use according to claim 1, wherein the pharmaceutical composition is in a dosage form selected from any one of capsules, tablets, granules, oral liquids, powders, suspensions or injections.
  5. 5. The use according to claim 1, wherein the health food, functional food or dietary supplement is in a dosage form selected from any one of oral liquid, tea, meal replacement powder, tabletted candy or capsule.
  6. 6. The use according to claim 1, wherein the product comprises one or more of the viable bacteria, inactivated bacteria, fermentation broth, and fermentation product extract of Lactiplantibacillus plantarum P as an active ingredient.
  7. 7. The method according to claim 6, wherein the fermentation product extract is prepared by inoculating the new strain into a fermentation medium, fermenting for 16-24 hours at 37 ℃ under anaerobic condition to obtain a fermentation broth, centrifuging the fermentation broth, filtering, collecting the supernatant, concentrating, and drying to obtain the fermentation product extract.
  8. 8. The application of the fermentation medium according to claim 7, wherein the pH value of the fermentation medium is 6.2-6.4, and the fermentation medium comprises, by weight, 37 parts of dry MRS (media management system), specifically 6.82 parts of peptone, 6.82 parts of beef extract, 3.41 parts of yeast extract, 13.64 parts of glucose, 1.36 parts of dipotassium hydrogen phosphate, 3.41 parts of sodium acetate, 1.36 parts of tri-ammonium citrate, 0.14 part of magnesium sulfate, 0.03 part of manganese sulfate and 63 parts of water.
  9. 9. The use according to any one of claims 1 to 8, wherein the viable bacteria content of Lactiplantibacillus plantarum P/517 is not less than 1 x 10 8 CFU/g or 1 x 10 8 CFU/mL and/or the amount of inactivated bacteria or fermentation product extract is added in a weight percentage of 0.1% -50%.
  10. 10. The use according to claim 1, wherein said product achieves relief of hypertension and related complications by modulating the renin-angiotensin system in vivo and reducing angiotensin converting enzyme, serum angiotensin II, plasma renin activity, angiotensinogen, aspartate aminotransferase content.

Description

Application of lactobacillus plantarum in preparation of products for relieving hypertension and related complications Technical Field The invention relates to the technical field of microbial medicines, in particular to application of lactobacillus plantarum in preparation of products for relieving hypertension and related complications. Background A long-term challenge faced in the field of cardiovascular health is that hypertension is a major cause of a variety of serious complications of the heart, brain and kidneys, and its means of control remain significantly limited. In the renin-angiotensin system (RAS) regulated by human blood pressure, angiotensin Converting Enzyme (ACE) is a key enzyme that catalyzes the conversion of angiotensin I to the potent vasoconstrictor substance angiotensin II, and its overactivation is one of the important pathological mechanisms leading to sustained elevation of blood pressure. This makes ACE an ideal target for hypotensive intervention. At present, although the chemical synthesized ACE inhibitor widely applied in clinic can effectively control blood pressure, adverse reactions such as dry cough, gustatory disorder, angioedema and the like caused by the ACE inhibitor can limit the long-term medication tolerance and compliance of patients to a certain extent. Therefore, the development of alternative inhibitors derived from natural products, which have both high safety and clear efficacy, has become an important research direction in the fields of functional foods and preventive medicine. In this context, the antihypertensive value of the probiotic metabolites is of increasing interest. In particular lactobacillus plantarum, which is capable of degrading food proteins and releasing short peptides with ACE inhibiting activity during growth or fermentation by means of a proteolytic system. The bioactive peptide generated by the microorganism in situ not only has good biocompatibility and safety, but also can play a synergistic effect of adjusting intestinal flora and improving metabolic health simultaneously due to the fact that the bioactive peptide is derived from probiotics, and provides a new path for realizing healthy intervention of food and medicine homology. Therefore, there is an urgent need in the art to screen and obtain a new strain of lactobacillus plantarum with clear, stable and multiple beneficial functions, which not only can effectively reduce blood pressure through various ways, but also has the potential to alleviate complications associated with hypertension, so as to provide a safer, multiple-effect and long-term use-suitable biological intervention scheme. Disclosure of Invention In order to solve the problems, the invention provides application of lactobacillus plantarum in preparing a product for relieving hypertension and related complications. The lactobacillus plantarum is screened from the feces of healthy adult people, has higher ACE inhibition activity and antioxidation activity, good safety and probiotic performance, has certain prevention and alleviation effects on hypertension and complications thereof, and has wide application prospect. The invention takes lactobacillus plantarum separated and identified in the feces of healthy adult population as a research object, and intervenes and treats the high-salt diet induced mouse hypertension and related complications through animal experiments, so as to provide a new thought for the application of probiotics and the treatment of common public health problems. The high-salt diet induced mouse hypertension and related complications model show that lactobacillus plantarum (Lactiplantibacillus plantarum) P517 can effectively reduce the high-salt diet induced hypertension and relieve various organ injuries caused by the hypertension. The lactobacillus plantarum P517 can be a probiotic with excellent performance and higher safety, and can effectively relieve diet-induced hypertension and related complications, so that the lactobacillus plantarum P517 has higher research value and application. In order to achieve the above purpose, the invention provides an application of lactobacillus plantarum in preparing a product for relieving hypertension and related complications, wherein the lactobacillus plantarum is classified and named Lactiplantibacillus plantarumP517 and is preserved in China Center for Type Culture Collection (CCTCC), and a 16S rDNA gene sequence with the preservation number of CCTCC NO: M20252435,Lactiplantibacillus plantarumP517 is shown as SEQ ID NO: 1. Further, the 16s rDNA sequence of the P517 strain was obtained by sequencing and was SEQ ID NO:1, concretely as follows: GGCGGTTGGGGGGGTGCCTAATACATGCAGTCGAACGAACTCTGGTATTGATTGGGTGCTTGCATCATGATTTACATTTGAGTGAGTGGCGAACTGGTGAGTAACACGTGGGAAACCTGCCCAGAAGCGGGGGATAACACCTGGAAACAGATGCTAATACCGCATAACAACTTGGACCGCATGGTCCGAGCTTGAAAGATGGCTTCGGCTATCACTTTTGGATGGTCCCGCGGCGTATTAGCTAGATGGTGGGGTAACGGCTCACCATGGCAATGATACGTAGCCGACCTGAGAGGGTAATCGGCCACATTGGGA