Search

CN-121975812-A - Aptamer capable of specifically recognizing neomycin and application thereof

CN121975812ACN 121975812 ACN121975812 ACN 121975812ACN-121975812-A

Abstract

The invention relates to an aptamer for specifically detecting neomycin and application thereof, and belongs to the technical field of detection. Firstly, the invention designs a new aptamer with good affinity to neomycin (the affinity reaches 1.17+/-0.32 mu M), and the aptamer has no reaction to other interference antibiotics such as Chloramphenicol (CAP), terramycin (OTC), enrofloxacin (ENR), azithromycin (AZT), roxithromycin (RXM), ciprofloxacin (CIP) and the like, and has good specificity. Secondly, the invention synthesizes two fluorescent signal probes of MOF@FITC and AgNCs, and constructs a ratio type fluorescent sensing system, and realizes high-precision and high-sensitivity detection of the target neomycin through double-signal ratio, thereby effectively eliminating the influence of background signals caused by environmental interference and fluorescent dye leakage.

Inventors

  • WANG ZHOUPING
  • GUO HUALIN
  • MA PENGFEI
  • Huang Gengli
  • LU XIAODONG

Assignees

  • 江南大学

Dates

Publication Date
20260505
Application Date
20260305

Claims (10)

  1. 1. An aptamer specifically recognizing neomycin, which is characterized in that the nucleotide sequence of the aptamer is shown as SEQ ID NO. 1.
  2. 2. The aptamer of claim 1, wherein the aptamer is modified at the 5 'or 3' end with a functional group or molecule.
  3. 3. Use of an aptamer according to claim 1 or 2 for detecting neomycin.
  4. 4. An aptamer sensor for detecting neomycin, the aptamer sensor comprising the aptamer of claim 1 or 2.
  5. 5. The aptamer sensor according to claim 4, characterized in that the aptamer sensor further comprises: a metal organic framework loaded with fluorescent dye; a first sequence comprising an aptamer sequence and having a stem-loop structure, a second sequence forming a triple helix structure with the stem of the first sequence; and the 5 'end or the 3' end is connected with a third sequence of the silver nanocluster, and the third sequence is partially complementarily paired with the first sequence.
  6. 6. The aptamer sensor of claim 5, wherein the stem of the first sequence and the second sequence form a triple helix structure by 2-14 bases.
  7. 7. The aptamer sensor of claim 5, wherein the first sequence is shown in SEQ ID No.2 and the second sequence is shown in SEQ ID No. 3.
  8. 8. The aptamer sensor of claim 5, wherein the third sequence is set forth in SEQ ID No. 4.
  9. 9. A method for detecting neomycin, comprising the steps of: S1, mixing a first sequence with a second sequence, then adding an activated metal organic framework and a fluorescent dye for co-incubation to obtain a fluorescent marker, wherein the first sequence is shown as SEQ ID NO.2, and the second sequence is shown as SEQ ID NO. 3; S2, respectively adding neomycin standard substances with different concentrations into a mixed system containing a fluorescent marker of S1 and a third sequence connected with silver nanoclusters for co-incubation, detecting the fluorescence intensity of the neomycin standard substances at 530nm and the fluorescence intensity of the neomycin standard substances at 630nm, calculating the ratio, and establishing a relation curve between the fluorescence intensity ratio and the neomycin concentration, wherein the third sequence is shown as SEQ ID NO. 4; s3, operating the sample to be detected according to the S2, detecting the fluorescence intensity, bringing the fluorescence intensity into a relation curve of the S2, and calculating to obtain the neomycin content in the sample to be detected.
  10. 10. The method of claim 9, wherein in step S1, the fluorescent dye comprises fluorescein isothiocyanate.

Description

Aptamer capable of specifically recognizing neomycin and application thereof Technical Field The invention relates to the technical field of detection, in particular to an aptamer specifically recognizing neomycin and application thereof. Background Antibiotics have attracted considerable attention in recent years as an important class of food and environmental pollutants due to their potential health risks and ecological impact on humans. The abuse and emission of antibiotics in the breeding industry is also one of the important sources of antibiotic pollution in the environment, and can lead to the generation and transmission of antibiotic resistance genes in water and soil, thereby exacerbating the global public health crisis. Among them, neomycin has serious ototoxicity and nephrotoxicity, and its residues in foods of animal origin (such as milk, honey, poultry, aquatic products) can accumulate in the human body through the food chain, which constitutes a potential threat to the health of consumers. Therefore, the establishment of a quick, sensitive and reliable neomycin residual detection method is important to guaranteeing food safety and ecological environment safety. Currently, aptamers are widely used as a nucleic acid molecule that efficiently recognizes targets for detection of various antibiotics. Current common strategies for improving aptamer affinity include truncation optimization, base mutation, introduction of chemical modification or functional groups, and the like. Wherein, the base mutation is used as a rational aptamer modification method, and has own unique advantages compared with other modification strategies. By site-directed mutagenesis of these critical region bases, e.g., mutation of a to G to enhance the hydrogen bonding network, efficient enhancement of affinity can be achieved. Of high note, neomycin mutant aptamer studies are not currently seen. It would therefore be of great interest if neomycin aptamer affinity could be improved by mutation. Disclosure of Invention Therefore, the technical problem to be solved by the invention is to overcome the problem that an aptamer for specifically detecting neomycin is lacking in the prior art. In order to solve the technical problems, the invention provides an aptamer for specifically detecting neomycin and application thereof. Firstly, the invention designs a new aptamer with good affinity to neomycin (the affinity reaches 1.17+/-0.32 mu M), and the aptamer has no reaction to other interference antibiotics such as Chloramphenicol (CAP), terramycin (OTC), enrofloxacin (ENR), azithromycin (AZT), roxithromycin (RXM), ciprofloxacin (CIP) and the like, and has good specificity. Secondly, the invention synthesizes two fluorescent signal probes of MOF@FITC and AgNCs, and constructs a ratio type fluorescent sensing system, and realizes high-precision and high-sensitivity detection of the target neomycin through double-signal ratio, thereby effectively eliminating the influence of background signals caused by environmental interference and fluorescent dye leakage. The first object of the invention is to provide an aptamer capable of specifically recognizing neomycin, wherein the nucleotide sequence of the aptamer is shown as SEQ ID NO. 1. Further, SEQ ID No.1: GGACTGAGGTACCACCTCAGTCC。 further, the 5 'end or the 3' end of the aptamer is modified with a functional group or a molecule. A second object of the present invention is to provide the use of the above-mentioned aptamer for detecting neomycin. A third object of the present invention is to provide an aptamer sensor for detecting neomycin, the aptamer sensor comprising: a metal organic framework loaded with fluorescent dye; a first sequence comprising an aptamer sequence and having a stem-loop structure, a second sequence forming a triple helix structure with the stem of the first sequence; and the 5 'end or the 3' end is connected with a third sequence of the silver nanocluster, and the third sequence is partially complementarily paired with the first sequence. Further, the stem of the first sequence forms a triple helix structure with the second sequence through 2-14 bases. Preferably, the stem of the first sequence and the stem of the second sequence form a triple helix by 8 bases. Further, the first sequence is shown as SEQ ID NO. 2. Further, SEQ ID No.2: TCTCTCTCGGACTGAGGTACCACCTCAGTCCACTAATAATTAACCCTCCCTCTCTCT。 Further, the second sequence is shown as SEQ ID NO. 3. Further, SEQ ID No.3: CCTCGA AGAGAGAG ACGT。 further, the third sequence is shown as SEQ ID NO. 4. Further, SEQ ID No.4: GGAGGGTTAATTATTCCTCC。 Further, the detection principle of the product of the invention is that the second sequence (TB) is complementarily paired with the stem part of the first sequence (TA) containing the aptamer sequence to form a triple helix structure (THMS), fluorescent dye and THMS are loaded in a Metal Organic Framework (MOF) to obtain MOF@FITC-THMS, a nucleic acid single chain (third sequence) r