Search

CN-121975814-A - Matricaria chamomilla salt tolerance gene ClbHLH and application thereof

CN121975814ACN 121975814 ACN121975814 ACN 121975814ACN-121975814-A

Abstract

The invention discloses a chamomile salt-tolerant gene C1bHLH3 and application thereof in improving chamomile salt tolerance, wherein the C1bHLH3 gene is obtained by separating chamomile from the chamomile, the nucleotide sequence is shown as SEQ ID NO. 1 in a sequence table, and the chamomile is genetically transformed by using an agrobacterium-mediated method through constructing an over-expression vector of the C1bHLH3 to obtain an over-expression strain of the C1bHLH3, and the growth rate, the plant height, the root number, the root length, the antioxidant enzyme activity and the like of the over-expression strain are obviously higher than those of wild chamomile under a salt stress environment, so that the C1bHLH3 gene has the capability of improving chamomile salt tolerance, provides a new research path for abiotic stress of crops, and has important theoretical and practical significance for revealing the molecular mechanism of chamomile salt tolerance and cultivating salt-tolerant crops.

Inventors

  • GAO RI
  • CAO YU
  • CONG YUFENG

Assignees

  • 高日

Dates

Publication Date
20260505
Application Date
20250813

Claims (8)

  1. 1. A chamomile salt-tolerant gene ClbHLH is characterized in that the nucleotide sequence of the chamomile salt-tolerant gene ClbHLH is shown as SEQ ID NO 1 in a sequence table.
  2. 2. Use of the chamomile salt-tolerance gene ClbHLH of claim 1to increase chamomile salt tolerance.
  3. 3. The use according to claim 2, wherein the overexpression of gene ClbHLH has a positive regulatory effect on salt tolerance of chamomile.
  4. 4. A protein encoded by the chamomile salt tolerance gene ClbHLH of claim 1, wherein the encoded protein has an amino acid sequence as shown in SEQ ID No. 2 of the sequence listing.
  5. 5. A primer for amplifying the chamomile gene ClbHLH of claim 1, wherein the primer is: ClbHLH3-F:TGCAGATATGGGAGACAA; ClbHLH3-R;ACCTGGACATCAATCCAA。
  6. 6. an over-expression vector obtained by inserting the chamomile salt tolerance gene ClbHLH of claim 1 into a pORE-R4-35SAA empty vector.
  7. 7. Constructing the over-expression vector as claimed in claim 6, wherein the specific primer HYG-F/R has the sequence of HYG-F CTTCTACACAGCCATCGGTCCAG (SEQ ID NO: 7); HYG-R:CGGAAGTGCTTGACATTGGGGAG(SEQ ID NO:8)。
  8. 8. A method for improving salt tolerance of chamomile, which is characterized in that the expression level of ClbHLH genes is improved.

Description

Matricaria chamomilla salt tolerance gene ClbHLH and application thereof Technical Field The invention relates to the technical field of biological genes, in particular to ClbHLH gene and application thereof in the aspect of salt tolerance. Background In natural environment, salinized soil is a complex process and is subjected to the combined action of multiple factors such as climate, topography, hydrology and geology. Saline-alkali soil becomes a key obstacle for restricting the normal growth and development of plants due to the characteristics of high salt content, strong alkalinity, poor physicochemical properties, low fertility and the like. The soil not only seriously hinders the growth of crops and reduces the agricultural productivity of the land, but also can generate a series of stress reactions under salt stress. In order to maintain the balance of the inside and outside of the cell, the water can be reversely diffused, the high osmotic pressure can lead the water of the root system cell to be externally permeated along the osmotic gradient, the cell dehydration is initiated, the water content of the root of the plant is lost, the ion absorption efficiency is poor and even inhibited, the plant body grows slowly, the phenomena of withering, wilting and the like occur, and the growth and the development of the plant and the yield are obviously inhibited. Chamomile is a perennial herb plant of the genus chamomile of the family Compositae, has strong root system and strong adaptability to drought environment. The chamomile has wide medical application, and flowers, leaves and roots of the chamomile can be used as medicines, so that the chamomile has various effects of clearing heat, detoxicating, reducing blood pressure and the like. During the production process of chamomile, various environmental stresses are often faced, wherein salt stress is one of key factors limiting the quality and yield of chamomile, and meanwhile, the planting range and yield of chamomile are severely limited, so that the sustainable development of the chamomile industry is limited. Therefore, the research on the physiological function and molecular mechanism of salt tolerance genes in the salt tolerance regulation of chamomile has important significance for improving the salt tolerance of chamomile and promoting the sustainable development of chamomile industry. Disclosure of Invention The invention aims to solve the technical problem of providing cloning and application of a chamomile salt-tolerant gene ClbHLH. The invention provides a chamomile salt-tolerant gene ClbHLH, the full length of the sequence is 1407bp, the sequence comprises 1368bp of maximum Open Reading Frame (ORF), and the total code of the sequence is 468 amino acids. The nucleotide sequence is shown as SEQ ID NO. 1 in the sequence table. The invention also provides an application of the chamomile salt-tolerant gene ClbHLH in improving the salt tolerance of chamomile. The gene ClbHLH has positive regulation and control effect on salt tolerance of chamomile, and the growth rate, plant height, root number, root length, antioxidant enzyme activity and the like of the over-expressed transgenic chamomile plant are obviously higher than those of wild chamomile under the condition of salt stress. The invention also provides a coded protein of the chamomile salt-tolerant gene ClbHLH, which has an amino acid sequence shown as SEQ ID NO. 2 in a sequence table. The invention also provides a method for obtaining the chamomile salt-tolerant gene ClbHLH, which comprises the steps of designing a specific primer ClbHLH-F/R by taking a CDS sequence of ClbHLH gene as a template, carrying out total extraction on RNA of chamomile by using a TIANGEN kit, completing preliminary synthesis of cDNA after removing genome DNA, screening positive strains carrying target DNA fragments after amplification by a PCR amplification technology, and confirming the target gene after sequencing. 0010. The further improvement is that the primer pair for PCR amplification is ClbHLH-F and ClbHLH-R, and the nucleotide sequence is as follows: ClbHLH3-F:TGCAGATATGGGAGACAA; ClbHLH3-R:ACCTGGACATCAATCCAA。 the further improvement is that the primer pair for fluorescent qPCR amplification is qRT-ClbHLH-F and qRT-ClbHLH-R, and the nucleotide sequences are as follows: qRT-ClbHLH3-F:CTTCAGACGCTTCATTCG; qRT-ClbHLH3-R:ATCGGAAGCCCAGACAGA。 the invention also provides an over-expression vector which is obtained by connecting a double-digested pORE-R4-35SAA empty vector with ClbHLH gene fragments by using T4DNA ligase. The further improvement is that the nucleotide sequence of the primer pair designed during the construction of the over-expression vector is as follows: HYG-F:CTTCTACACAGCCATCGGTCCAG; HYG-R:CGGAAGTGCTTGACATTGGGGAG。 The invention has the beneficial effects that the cloned chamomile salt-tolerant gene ClbHLH is provided, and the characteristics of ClbHLH gene expression and the like are clarified thr