Search

CN-121975829-A - Phospholipase A1Gene and application thereof

CN121975829ACN 121975829 ACN121975829 ACN 121975829ACN-121975829-A

Abstract

The invention discloses a phospholipase A 1 gene and application thereof, relating to the technical field of bioengineering, and the technical scheme is that the phospholipase A 1 gene has a nucleotide sequence shown as SEQ ID No. 1; specific primers for extending the phospholipase A 1 gene are F-pPink: CGAGAAAAGGCCTATGTTTTCTTTGGCTAGATT and R-pPink: GTAGTAGTAGTGATTCCATGGCCGGCCGGTA.

Inventors

  • KONG QING
  • ZHAO KE
  • SONG WENLING

Assignees

  • 青岛生创晶合生物技术有限公司

Dates

Publication Date
20260505
Application Date
20251023

Claims (7)

  1. 1. A phospholipase A 1 gene is characterized in that the nucleotide sequence is shown in SEQ ID No. 1.
  2. 2. The phospholipase a 1 gene of claim 1 wherein the specific primers that expand the phospholipase a 1 gene are: F-pPink:CGAGAAAAGGCCTATGTTTTCTTTGGCTAGATT; R-pPink:GTAGTAGTAGTGATTCCATGGCCGGCCGGTA。
  3. 3. A biological material, which is characterized in that the biological material is an expression product of phospholipase A 1 gene shown as SEQ ID No.1, or an expression vector and a transformant containing pPink alpha HC-PLA 1 plasmid.
  4. 4. Use of the phospholipase a 1 gene to catalyze transesterification by immobilizing the expression product of the phospholipase a 1 gene of claim 3.
  5. 5. The use of the phospholipase a 1 gene as claimed in claim 4 wherein the catalytic transesterification is to catalyze the reaction of PC with ethyl type fish oil to synthesize DHA/EPA type phospholipids.
  6. 6. The use of phospholipase A 1 gene as claimed in any of claims 4-5, wherein the conditions of the catalytic reaction are a mass ratio of phospholipid to ethyl ester type fish oil of 1:5, an enzyme loading of 25%, a reaction temperature of 60 ℃, a water content of 0.75% and a reaction time of 32: 32 h.
  7. 7. The use of the phospholipase A 1 gene of claim 4, wherein the immobilized carrier includes, but is not limited to, a macroporous exchange resin, a macroporous adsorption resin.

Description

Phospholipase A 1 gene and application thereof Technical Field The invention relates to the technical field of bioengineering, in particular to a phospholipase A 1 gene and application thereof. Background DHA/EPA type phospholipids derived from natural sources are mainly found in marine organisms, including the eggs and viscera of deep sea fish such as salmon, tuna and sardine, and krill, microalgae, oyster and squid. Although many researches show that marine fish is a good source of DHA/EPA phospholipids, the method for directly obtaining the DHA/EPA phospholipids with high concentration from fish can be industrially applied only through a complex multi-stage purification process. Meanwhile, due to the stability of ocean sources and the problem of ocean heavy metal pollution, the yield of the marine heavy metal pollution can not meet the demands of people. The main way to obtain the desired DHA/EPA phospholipids is currently to modify the natural phospholipids by manual intervention. The enzymatic conversion mainly takes soybean phospholipids, ethyl ester type DHA/EPA and other industrial byproducts as raw materials, and the soybean phospholipids, the ethyl ester type DHA/EPA and other industrial byproducts are converted into phospholipid type DHA/EPA under the action of biological enzymes. The method is green, low in carbon, rapid in reaction, single in product and suitable for large-scale production and application. Thus, enzymatic modification of DHA/EPA using inexpensive vegetable lecithin (PC, phosphatidylcholine) and abundant ethyl ester form may be an effective method for obtaining DHA/EPA-enriched phospholipids. Phospholipase a 1(PLA1) is widely found in natural organisms and hydrolyzes the ester bond at the sn-1 position of the phospholipid to form 2-acyl lysophospholipids and free fatty acids. Studies have shown that PLA 1 has a relatively broad substrate specificity, and has a certain lipase activity in addition to the activity of PLA 1 and A 2. Since DHA and EPA both show a preference for the sn-1 site in phospholipids and DHA and EPA esterified at the sn-1 position of the phospholipids show a better bioavailability, PLA 1 is often used for the synthesis of DHA/EPA type phospholipids. However, the commercial PLA 1 currently used for the preparation of DHA/EPA phospholipids is mainly derived from foreign company protein engineering strains of thermomyces lanuginosus and fusarium oxysporum (DHA/EPA binding > 20%). The industrial enzyme preparation with independent intellectual property rights is not available in the field in China, and the industrial enzyme preparation becomes a key bottleneck for restricting the development of the industry. Disclosure of Invention Aiming at the defects existing in the prior art, the first aim of the invention is to provide a phospholipase A 1 gene, wherein the gene is a gene with optimized codons, and the enzyme activity is greatly improved after expression. A second object of the present invention is to provide the use of the above phospholipase A 1 gene. In order to achieve the first purpose, the invention provides a technical scheme that a phospholipase A 1 gene has a nucleotide sequence shown as SEQ ID No. 1. Further, specific primers for expanding the phospholipase A 1 gene are as follows: F-pPink:CGAGAAAAGGCCTATGTTTTCTTTGGCTAGATT; R-pPink:GTAGTAGTAGTGATTCCATGGCCGGCCGGTA。 The invention also provides a biological material which is an expression product of the phospholipase A 1 gene or an expression vector and a transformant containing pPink alpha HC-PLA 1 plasmid. The invention also provides an application of the phospholipase A 1 gene, and the expression product of the phospholipase A 1 gene is immobilized to catalyze transesterification. Further, the immobilization carrier is macroporous exchange resin or macroporous adsorption resin. Further, the transesterification is to catalyze the reaction of PC and ethyl-type fish oil to synthesize DHA/EPA type phospholipid. Further, the condition of the catalytic reaction is that the mass ratio of the phospholipid to the ethyl ester type fish oil is 1:5, the enzyme adding amount is 25%, the reaction temperature is 60 ℃, the water content is 0.75%, and the reaction time is 32 h. In summary, the invention has the following beneficial effects: The invention discloses a method for preparing a phospholipid acid, which comprises the steps of preparing a phospholipid A 1 gene with optimized codons, realizing the expression of a PLA 1 source from Aspergillus oryzae through a PICHIAPINKTM expression system, and expressing PLA 1 in a secretion form, carrying out amplification culture, wherein the maximum enzyme activity is 114.30 +/-1.41U/mL, compared with the enzyme activity (7.70+/-34/mL) reported in a literature before codon optimization (Watanabe, koishi, yao, tsuji, & Serizawa, 1999), the method is high in 1384%, successfully integrating a fish oil n-3 PUFA residue into soybean PC by utilizing immobilized PLA 1, carrying