Search

CN-121975837-A - Method for endogenously improving wax content of peel and prolonging shelf life of tomato fruits

CN121975837ACN 121975837 ACN121975837 ACN 121975837ACN-121975837-A

Abstract

The invention discloses a method for improving the wax content of peel and prolonging the shelf life of tomato fruits by endogenous, belongs to the field of biological genes, and aims to solve the problem that the prior art can regulate and control the expression of genes related to the wax metabolism of tomato fruits by exogenous jasmonic acid so as to prolong the shelf life of tomato fruits, and the method can maintain remarkable effect only by continuous or high-concentration treatment. The invention reduces the endogenous jasmonic acid content of tomato fruits by over-expressing SlC H73 genes. Meanwhile, the invention can obviously improve the thickness of the cuticle of the epidermis of the tomato fruit and the storage property of the tomato fruit, thereby creating the storage-resistant tomato germplasm.

Inventors

  • DENG HENG
  • GAO YONGFENG
  • Jin Qiuwu
  • GAO SHENZHONG
  • SHI ZHAN
  • LIU JIKAI

Assignees

  • 西南科技大学

Dates

Publication Date
20260505
Application Date
20251231

Claims (8)

  1. 1. A method for prolonging the shelf life of tomato fruits reduces the endogenous jasmonic acid content of tomato fruits and improves the waxy content of tomato peel at the same time by over-expression of SlC H73 genes so as to prolong the shelf life of tomato fruits.
  2. 2. The method according to claim 1, wherein the tomato germplasm material with reduced endogenous jasmonic acid content, thickened out cornea layer and long shelf life is prepared by over-expressing SlC H73 gene in tomato by gene editing.
  3. 3. A method for improving the waxy content of tomato peel to prolong the shelf life of tomato fruits, which is characterized in that through the overexpression of SlC H73 genes, the endogenous jasmonic acid content of tomato fruits is reduced, the waxy content of tomato peel is improved, and the shelf life of tomato fruits is prolonged; the nucleotide sequence of SlC H73 gene is shown in SEQ ID NO.1, and the amino acid sequence of protein coded by SlC H73 gene is shown in SEQ ID NO. 2.
  4. 4. A method according to claim 3, characterized in that SlC H73 is overexpressed in plants by transgenic means, and positive plants are obtained by screening, which positive plants are SlC H73 overexpressed tomato plants, targeting the plants to be treated.
  5. 5. A material prepared by the method of claim 3 or 4.
  6. 6. The material according to claim 5, wherein the tomato fruit prepared by the method can not significantly improve the shelf life of the tomato fruit by spraying jasmonic acid on the surface of the tomato fruit.
  7. 7. The use of the aforementioned method for endogenously increasing the waxy content of tomato peel to extend the shelf life of tomato fruits, characterized in that the method is used in the preparation of tomato fruits with a low endogenous jasmonic acid content.
  8. 8. Use according to claim 6 or 7, characterized in that the method is used for improving the storage properties of tomato fruits.

Description

Method for endogenously improving wax content of peel and prolonging shelf life of tomato fruits Technical Field The application relates to the field of biological genes, in particular to a method for improving the wax content of peel and prolonging the shelf life of tomato fruits by endogenous. More specifically, the application provides a method for improving the waxy content of tomato peel endogenously so as to prolong the shelf life of tomato fruits, which effectively improves the waxy content of tomato peel and greatly prolongs the shelf life of tomato fruits by overexpressing transcription factor C3H73 of tomato. Background In the prior art, a mode of spraying jasmonic acid on the surface of the tomato fruits is generally adopted to prolong the shelf life of the tomato fruits. Research shows that exogenous Jasmonic Acid (JA) can improve the waxy content of the skin of tomato fruits by regulating and controlling the expression of the related genes of waxy metabolism of the fruits, thereby delaying the water loss and softening process and indirectly prolonging the shelf life of the fruits. However, there is a certain dependence on the effect of jasmonic acid treatment, and the effect of conventional treatment on fruit elongation shelf life of different tomato varieties and development stages is obviously different, and continuous or high-concentration treatment is required to maintain remarkable effect. For this reason, a new method is urgently needed to extend the shelf life of tomatoes. Disclosure of Invention The application aims to provide another method for prolonging the shelf life of tomato fruits, which aims at solving the problem that the prior art can prolong the shelf life of the tomato fruits by regulating and controlling the expression of the waxy metabolism related genes of the tomato fruits through exogenous jasmonic acid and can maintain remarkable effect through continuous or high-concentration treatment. More specifically, the application provides a method for improving the wax content of peel and prolonging the shelf life of tomato fruits by endogenous, which can obviously improve the thickness of the cuticle of the epidermis of the tomato fruits and the storage property of the tomato fruits by over-expressing SlC H73 genes, thereby creating storage-resistant tomato germplasm. In order to achieve the above purpose, the present application adopts the following technical scheme: a method for prolonging the shelf life of tomato fruits reduces the endogenous jasmonic acid content of tomato fruits and improves the waxy content of tomato peel at the same time by over-expression of SlC H73 genes so as to prolong the shelf life of tomato fruits. Through gene editing, slC H73 genes are overexpressed in tomatoes, and tomato germplasm materials with reduced endogenous jasmonic acid content, thickened cornea layer and long shelf life are prepared. A method for reducing the content of endogenous jasmonic acid in tomato fruits by using genetic engineering technology, wherein the selected gene is SlC H73 gene of tomato. A method for prolonging the shelf life of tomato fruits by using genetic engineering technology, wherein the selected gene is SlC H73 gene of tomato. A method for improving the waxy content of tomato peel endogenously to prolong the shelf life of tomato fruits reduces the endogenous jasmonic acid content of tomato fruits, improves the waxy content of tomato peel and prolongs the shelf life of tomato fruits through the overexpression of SlC H73 genes; the nucleotide sequence of SlC H73 gene is shown in SEQ ID NO.1, and the amino acid sequence of protein coded by SlC H73 gene is shown in SEQ ID NO. 2. And taking the tomato plant to be treated as an object, performing overexpression on SlC H73 in a plant body by a transgenic method, and screening to obtain a positive plant, wherein the positive plant is the tomato plant with the overexpression of SlC H73. The tomato plant has high waxy content of tomato fruit, and is beneficial to prolonging shelf life of tomato fruit. There is no need to extend the shelf life of the tomato fruit by spraying jasmonic acid onto the surface of the tomato fruit. When the jasmonic acid is sprayed to the surface of the tomato fruits, the shelf life of the tomato fruits cannot be remarkably improved by the sprayed jasmonic acid. Use of the foregoing method for endogenously increasing the waxy content of tomato pericarp to extend the shelf life of tomato fruit. The method is used in the preparation of tomato fruits with low endogenous jasmonic acid content. The method is used for improving the storage property of tomato fruits. The nucleotide sequence of the gene SEQ ID No. 1-C3H 73 is as follows :ATGGTTAAGCTCCACTTTTTATCACCCCTTTATATACAAACCGATCATCACCGCCTGAACTTCAAATCGCCACCACTTTTTCAACTAGCAATGATCGGAGAAAGAAGTCGCCGGATTCCGACGGTTGATGTTCCGCCGTGGTCGTACTCCGATGATCAAACGGCGAACATGCAGTTCATGTTAAGCCCTAGTACAAATTCCATTTCTACCCCTAATAATTTCAATTTCAGTAACTTTATTGTTGAAGATGATTATCCTCTGTTTTGT