Search

CN-121975910-A - Construction method and application of spherical DNA nano machine for detecting MGMT

CN121975910ACN 121975910 ACN121975910 ACN 121975910ACN-121975910-A

Abstract

The invention discloses a preparation method of a spherical DNA nano machine for detecting O 6 -methylguanine-DNA methyltransferase (MGMT) and application thereof in detecting expression level of tumor cells MGMT. Firstly, DNA WALKER with MGMT identification and signal amplification functions is designed, and is fixed on the surface of a gold nanosphere through sulfhydryl modification, so that a spherical DNA nano machine is constructed. When MGMT interacts with DNA WALKER chains, methylated base G on DNase can be repaired, thereby recovering DNase activity, initiating enzyme cleavage reaction, breaking and releasing Track chain marked with fluorescent group, generating fluorescent signal change, and realizing high-sensitivity detection of MGMT. The method can realize effective detection of MGMT protein in a low concentration range, and has good biomedical application prospect.

Inventors

  • WANG ZHAOYIN
  • HU WENTING
  • XU ZIQI

Assignees

  • 南京师范大学

Dates

Publication Date
20260505
Application Date
20260204

Claims (10)

  1. 1. The construction method of the spherical DNA nano machine for detecting the MGMT is characterized by comprising the following steps of: S1, preparing nano gold balls, namely adding a HAuCl 4 solution with the concentration of 100 ml being 1 mM into a three-necked flask, heating in an oil bath, stirring at the same time, quickly adding a sodium citrate solution with the concentration of 10 ml being 38.8 mM until the liquid boils, changing the liquid into dark red within 1 minute, keeping heating for 20 minutes, stopping heating, stirring and cooling to room temperature, and preserving at 4 ℃ in a dark place; S2, designing a Walker chain and a Track chain of a DNAWALKER system, namely designing a methylated DNAzyme as the Walker chain, wherein a G base of the DNAzyme is replaced by a methylated G base, the specific sequence is SH-T 30 GTATCTCACTCCGAGCCGGTC/O 6 MeG/AAATCTCTGCTCTGG, designing a fluorescence quenched substrate chain as the Track chain, namely modifying a FAM group on the substrate chain as a signal molecule for generating a fluorescence signal, designing a connecting chain for modifying a BHQ1 group to quench the FAM signal, and the specific sequence is FAM-CCAGAGCAGAGAT/rA/GGTGAGATACAGCACGCCCGAGA and SH-TTTCTCGGGCGTGCT-BHQ1; S3, assembling the DNA nanometer machine, namely (a) assembling double chains, namely annealing two Track chains, wherein FAM-rA is BHQ1=1:1-1.5. (b) Opening disulfide bond, adding TECP into mercapto DNA, reacting at 4 deg.C in refrigerator for 1.5h, centrifugal washing with desalting column at 5000 rpm for 1.1 min to obtain required mercapto DNA, and (C) modifying gold ball by co-freezing method, adding AuNPs solution into 1.5mL EP tube, adding treated mercapto DNA, wherein Walker chain: track chain=1:20, mixing instrument 30 s, and placing in-20 deg.C refrigerator for 4-5 h. (d) Washing and concentrating, namely naturally thawing frozen gold balls, centrifugally washing with a washing buffer containing 10 mM PB,0.1M NaCl,0.01% SDS at 10000rpm for 30 min, shaking and mixing uniformly, removing unconnected DNA, washing, concentrating, and storing at 4 ℃.
  2. 2. The method for constructing a spherical DNA nano machine for detecting MGMT according to claim 1, wherein in step S1, before synthesis, all glassware is soaked in aqua regia, washed with ultrapure water and then dried, and the volume ratio of HCl to HNO 3 in the aqua regia is 3:1.
  3. 3. The method of constructing a spherical DNA nanomachine for the detection of MGMT according to claim 1, wherein the buffer for double strand synthesis in step S3 (a) is a buffer having PH8.0 and comprising 10 mM Tris HCl and 100 mM NaCl.
  4. 4. The method for constructing a spherical DNA nanomachine for detecting MGMT according to claim 1, wherein the final concentration of the FAM chain in the step S3 (a) is 20. Mu.M, the reaction volume is 50. Mu.L, and the synthesis ratio of the FAM chain to the BHQ1 chain is 1:1-1.5.
  5. 5. The method of constructing a spherical DNA nanomachine for the detection of MGMT according to claim 1, wherein TCEP is added in the concentration of 10 mM in step S3 (b) in an amount of 0.2 μl according to the ratio of the amount of thiol chain and TCEP substance of 1:2.
  6. 6. The method for constructing a spherical DNA nanomachine for detecting MGMT according to claim 1, wherein the desalting column in step S3 (b) is centrifuged to remove the original water before use, and the desalting column is centrifugally washed 1 time with 1 XPBS buffer solution with pH of 7.4, and the thiol DNA is centrifugally washed 3 times with centrifugation parameters of 5000 rpm for 1 min.
  7. 7. The method of constructing a spherical DNA nanomachines for the detection of MGMT according to claim 1, wherein in step S3 (c), au NPs is added in a volume of 1 mL at a concentration of 10 nM.
  8. 8. The method of constructing a spherical DNA nanomachine for the detection of MGMT according to claim 1, wherein the concentration of the Walker strand added in step S3 (c) is 10. Mu.M, the volume is 5. Mu.L, the concentration of the Track strand is 20. Mu.M, and the volume is 50. Mu.L.
  9. 9. The construction method of a spherical DNA nanomachine for detecting MGMT according to claim 1, wherein the concentration by centrifugation in step S3 (d) is 50 μl.
  10. 10. The application of the spherical DNA nanometer machine obtained by adopting the construction method according to any one of claims 1-9 in MGMT detection is characterized by comprising the specific processes of preparing MGMT solutions with different concentrations, adding an equivalent prepared DNA nanometer machine, incubating at 37 ℃ for 3.5 h, testing fluorescence signals of the MGMT solutions, obtaining a linear relation between fluorescence signal intensity and MGMT concentration, and searching corresponding concentrations on the linear curve according to the measured fluorescence signal intensity when detecting the MGMT with unknown concentration, thereby obtaining the specific concentration of the MGMT, wherein the concentration of the MGMT solution is 10 -5 -10 -1 ng/. Mu.L.

Description

Construction method and application of spherical DNA nano machine for detecting MGMT Technical Field The invention belongs to the technical field of biological detection, and relates to a construction method and application of a spherical DNA nano machine for detecting MGMT. Background O 6 -methylguanine-DNA methyltransferase (MGMT) is a key DNA repair protein that directly eliminates the alkylated adduct at position O 6 of DNA, thereby maintaining genomic stability. In clinical treatment of malignant tumors such as glioblastoma, the expression level of MGMT protein in tumor cells is a key factor for determining the curative effect of alkylating chemotherapeutic drugs (such as temozolomide and TMZ). The high expression MGMT protein can repair DNA damage caused by medicines, so that the tumors generate drug resistance, and conversely, the low expression or the lack thereof indicates better chemotherapy response. Therefore, the accurate quantitative detection of the MGMT protein expression level has extremely important clinical value for the establishment of a patient chemotherapy scheme, the prediction of curative effect and the prognosis evaluation. In recent years, biological sensing technology based on functional nucleic acid provides a new idea for protein detection. In particular to a DNA nanometer machine with a signal amplification function, which is hopeful to realize high-sensitivity detection by coupling target recognition and cascade reaction. The invention constructs a spherical DNA nano machine integrated with a specific recognition and high-efficiency signal amplification module, and provides a novel solution for the accurate quantitative detection of MGMT protein. Disclosure of Invention In order to solve the problems, the invention discloses a preparation method and application of a DNA nano machine for detecting MGMT. In order to achieve the above purpose, the technical scheme of the invention is as follows: a construction method of a spherical DNA nano machine for detecting MGMT comprises the following steps: S1, preparing gold nanospheres, namely adding a 100ml HAuCl 4 solution (1 mM) into a three-necked flask, heating by an oil bath, stirring until the liquid boils, quickly adding a 10 ml sodium citrate solution (38.8 mM), changing the liquid into dark red within 1 minute, keeping heating for 20 minutes, stopping heating, stirring and cooling to room temperature, and preserving at 4 ℃ in a dark place, testing the ultraviolet visible absorption spectrum of the prepared gold nanospheres, and calculating the initial concentration of the gold nanospheres according to the lambert law (the extinction coefficient of AuNP at 520 nm is 2.7X10 8M-1cm-1); S2, designing a Walker chain and a Track chain of a DNAWALKER system, namely designing a methylated DNAzyme as the Walker chain, wherein a G base of the DNAzyme is replaced by a methylated G base, the specific sequence is SH-T 30GTATCTCACTCCGAGCCGGTC/O6 MeG/AAATCTCTGCTCTGG, designing a fluorescence quenched substrate chain as the Track chain, namely modifying a FAM group on the substrate chain as a signal molecule for generating a fluorescence signal, and designing a connecting chain for modifying a BHQ1 group to quench the FAM signal, wherein the specific sequences are FAM-CCAGAGCAGAGAT/rA/GGTGAGATACAGCACGCCCGAGA and SH-TTTCTCGGGCGTGCT-BHQ1. S3, assembling the DNA nanometer machine, namely (a) assembling double chains, namely annealing two Track chains (FAM-rA: BHQ1=1:1-1.5). (b) Opening disulfide bond, adding proper quantity of TECP into mercapto DNA, making reaction in 4 deg.C refrigerator 1.5 h, centrifugal washing with desalting column (5000 rpm,1 min) to obtain the required mercapto DNA, and (C) using co-freezing method to modify gold ball, adding AuNPs solution into 1.5 mL EP tube, adding treated mercapto DNA (Walker chain: track chain=1:20), mixing uniformly with 30 s, placing in-20 deg.C refrigerator 4-5 h. (d) Washing and concentrating, namely naturally thawing frozen gold balls, centrifugally washing with a washing buffer (10 mM PB,0.1M NaCl,0.01% SDS) (10000 rpm,30 min), shaking and mixing uniformly, removing unconnected DNA, washing, concentrating, and storing at 4 ℃. Further, all glassware is soaked in aqua regia (HCl/HNO 3, 3:1) and rinsed with ultra pure water before the synthesis is performed in step S1, and then dried. Further, the buffer for double strand synthesis in step S3 (a) was 10 mM Tris HCl (ph=8.0, 100: 100 mM NaCl). Further, the final concentration of FAM chain in step S3 (a) was 20. Mu.M, the reaction volume was 50. Mu.L, and the synthesis ratio of FAM chain and BHQ1 chain was 1:1-1.5. Further, TCEP was added at a concentration of 10mM in step S3 (b) in an amount of 1:2 in terms of the ratio of the amount of thiol chain and TCEP substance, i.e., 0.2. Mu.L. Further, the desalting column in step S3 (b) was centrifuged to remove the original water before use, and the desalted column was washed 1 time with buffer (1 XPBS,