CN-121975921-A - Specific molecular marker method for identifying genetic sex of macrobrachium rosenbergii and application
Abstract
The invention relates to the technical field of aquatic genetic breeding and discloses a specific molecular marker method for identifying the genetic sex of macrobrachium rosenbergii and application thereof, comprising the following steps of S1, obtaining a macrobrachium rosenbergii individual sample and extracting genome DNA of the macrobrachium rosenbergii individual; S2, carrying out whole genome re-sequencing on genome DNA of female macrobrachium rosenbergii and male macrobrachium rosenbergii, obtaining candidate specific nucleotide sequences with differences between male and female individuals through bioinformatics analysis and screening, and S3, designing PCR amplification primers based on the candidate specific nucleotide sequences, and screening to obtain specific molecular markers for genetic sex identification of macrobrachium rosenbergii. The specific molecular marker is constructed by carrying out whole genome re-sequencing on female macrobrachium rosenbergii and male macrobrachium rosenbergii and obtaining specific nucleotide sequences with differences between male and female individuals based on bioinformatics analysis and screening, so that the limitation caused by sex judgment only depending on external morphology or development stage is avoided.
Inventors
- GAO QIANG
- CHENG SHUN
- CHI MEILI
- LUO JUNZHI
- ZHENG JIANBO
- ZHANG HAIQI
- Rui Qianlong
- LI FEI
- ZHU CHAO
- LIU SHILI
- JIANG WENPING
Assignees
- 浙江省淡水水产研究所(浙江省淡水渔业环境监测站)
Dates
- Publication Date
- 20260505
- Application Date
- 20260206
Claims (10)
- 1. The specific molecular marking method for identifying the genetic sex of the macrobrachium rosenbergii is characterized by comprising the following steps of: S1, obtaining a macrobrachium rosenbergii individual sample and extracting genome DNA of the macrobrachium rosenbergii individual; S2, carrying out whole genome re-sequencing on genome DNA of female macrobrachium rosenbergii and genome DNA of male macrobrachium rosenbergii, and obtaining candidate specific nucleotide sequences with differences between male and female individuals through bioinformatics analysis and screening; s3, designing PCR amplification primers based on the candidate specific nucleotide sequences, and screening to obtain specific molecular markers for genetic sex identification of macrobrachium rosenbergii; s4, taking genomic DNA of the macrobrachium rosenbergii to be detected as a template, and carrying out PCR amplification by adopting a primer corresponding to the specific molecular marker; S5, detecting PCR amplification products, and judging the genetic sex of the macrobrachium rosenbergii to be detected according to the amplification results.
- 2. The method for identifying the genetic sex of macrobrachium rosenbergii according to claim 1, wherein in the step S1, the genomic DNA is derived from muscle tissue of macrobrachium rosenbergii, and is extracted by a genomic DNA extraction kit, the concentration of the DNA is detected by using Nanodrop ND2000, and the integrity of the DNA is detected by using 1.0% -2.0% agarose gel electrophoresis.
- 3. The method for identifying the genetic sex of macrobrachium rosenbergii according to claim 1, wherein in the step S2, the whole genome resequencing data of the male macrobrachium rosenbergii is assembled to construct a reference genome, and the whole genome resequencing data of the female macrobrachium rosenbergii is compared to the reference genome, so that candidate specific nucleotide sequences are screened.
- 4. The method for identifying the genetic sex of macrobrachium rosenbergii according to claim 1, wherein in the step S3, the step of screening is as follows: And carrying out PCR amplification verification on the candidate specific nucleotide sequence, and screening to obtain a primer pair with difference in amplification results in the male and female macrobrachium rosenbergii as the specific molecular marker.
- 5. The method for identifying the genetic sex of macrobrachium rosenbergii according to claim 4, wherein the specific molecular markers comprise Marker19, marker28, marker52 and Marker53; The nucleotide sequence of the forward primer of Marker19 is SEQ ID NO.1: GAGGAATGTTTACTAGAGAAAG; The nucleotide sequence of the reverse primer is SEQ ID NO.2: TGTTCAATTCTTTAAAACCTC; the nucleotide sequence of the forward primer of Marker28 is SEQ ID NO.3: GAGGCCATTACAGATCTCCCAAA; the nucleotide sequence of the reverse primer is SEQ ID NO.4: ACCGACTGACCTGTATGTTGAG; The nucleotide sequence of the forward primer of Marker52 is SEQ ID NO.5: TACCACACTTCATTCAAATCTA; the nucleotide sequence of the reverse primer is SEQ ID NO.6: ATGTGATCACAGAGGATTTCGG; The nucleotide sequence of the forward primer of Marker53 is SEQ ID NO.7: TAGTGTACGTTTGGTTGAATCC; The nucleotide sequence of the reverse primer is SEQ ID NO.8: CATAATGACCACTTGTATCAC.
- 6. The method for identifying the genetic sex of macrobrachium rosenbergii according to claim 1, wherein in the step S4, the total volume of the reaction system for PCR amplification is 10-30. Mu.L, the reaction system comprises 5-15. Mu.L of 2 XEs-Taq buffer, 0.5-1.5. Mu.L of forward primer, 0.5-1.5. Mu.L of reverse primer, 0.5-1.5. Mu.L of genomic DNA template and the balance of deionized water.
- 7. The method for identifying the genetic sex of macrobrachium rosenbergii according to claim 1, wherein in the step S4, the PCR amplification procedure comprises pre-denaturation at 90-98 ℃ for 2-10min, followed by 25-40 cycles, each cycle comprising denaturation at 90-98 ℃ for 10-60S, annealing at 50-65 ℃ for 20-60S, and extension at 72 ℃ for 30S-2min, and final extension at 72 ℃ for 2-10min after the end of the cycle.
- 8. The method for identifying genetic sex of macrobrachium rosenbergii according to claim 1, wherein in the step S5, when PCR amplification is performed by using Marker19 and electrophoresis detection is performed, the detection of a single specific band is determined as female macrobrachium rosenbergii, and the detection of no amplified band is determined as male macrobrachium rosenbergii.
- 9. The method for identifying genetic sex of macrobrachium rosenbergii according to claim 1, wherein in the step S5, when PCR amplification is performed by using Marker28, marker52 or Marker53 and electrophoresis detection is performed, two bands are detected to determine female macrobrachium rosenbergii, and a single band is detected to determine male macrobrachium rosenbergii.
- 10. The specific molecular marker method according to any one of claims 1 to 9, which is used for genetic sex identification of macrobrachium rosenbergii.
Description
Specific molecular marker method for identifying genetic sex of macrobrachium rosenbergii and application Technical Field The invention relates to the technical field of aquatic genetic breeding, in particular to a specific molecular marker method for identifying the genetic sex of macrobrachium rosenbergii and application thereof. Background Macrobrachium rosenbergii (Macrobrachiumrosenbergii), also known as macrobrachium nipponensis, belongs to the order of the decapod (Decapoda), the family of the macrobrachium nipponensis (Palaemonidae) and the genus of the macrobrachium (Macrobrachium), is naturally distributed in the saline fresh water domains of various countries in southeast Asia, and is an important freshwater economic culture variety in China. The economic characters such as growth speed, individual size and the like of the male and female crustaceans of the decapod crustaceans are obviously different, and the macrobrachium rosenbergii also has obvious sex dimorphism characteristics, and the characteristic that the growth speed of male individuals is obviously faster than that of female, and the size of the sexually mature male shrimps can be 1.5-2 times that of female shrimps. In addition, when the male and female macrobrachium rosenbergii are mixedly bred, the female macrobrachium rosenbergii is easy to hold eggs in advance, so that growth arrest is caused, and the male macrobrachium rosenbergii fights in the breeding period to increase the death rate. Therefore, the whole male population is cultivated by sex control, the whole growth rate and the market specification can be greatly improved, the cultivation period is shortened, and the cultivation yield and the economic benefit are improved. With the rapid development of high throughput sequencing technology and iterative updating of aquatic species genome resources, more and more economic shrimp sex markers are reported to be found in succession, such as portunus trituberculatus (Portunus trituberculatus), scylla paramamosain (Scylla paramamosain), penaeus vannamei (Litopeneaus vannamei), eriocheir sinensis (Eriocheir sinensis) and procambarus clarkia (Cherax quadricarinatus). In terms of macrobrachium rosenbergii sex marker identification, a molecular marker with specific macrobrachium rosenbergii sex is disclosed by searching and bulletin number CN102719531B, a 300bp DNA fragment with the sequence of SEQ ID NO:23 is separated from a macrobrachium rosenbergii genome, and can be used for detecting macrobrachium rosenbergii sex. The screening method of the sex-specific molecular marker comprises the steps of extracting DNA of macrobrachium rosenbergii, AFLP analysis, cloning of sex-specific fragments, design of specific primers, detection of feasibility of the sex-specific fragments and the like. The invention screens out the molecular markers specific to the females of the macrobrachium rosenbergii, establishes the genetic sex identification method of the macrobrachium rosenbergii, and can accurately and stably detect the molecular markers when the macrobrachium rosenbergii grows earlier and the sex cannot be determined in appearance, thereby being beneficial to establishing a unisexual culture system and improving the yield. The female specific fragment obtained in the genome of macrobrachium rosenbergii provides a necessary condition for positioning on a chromosome. Through searching, the bulletin number is CN111996261B, a macrobrachium rosenbergii sex molecular marker primer is disclosed, the primer comprises a primer pair 1, the primer pair 1 comprises a Contig-1 upstream primer and a Contig-1 downstream primer, wherein the nucleotide sequence of the Contig-1 upstream primer is shown as SEQ ID NO. 1, and the nucleotide sequence of the Contig-1 downstream primer is shown as SEQ ID NO. 2. The primer can identify female and male macrobrachium rosenbergii at the molecular level. The invention also discloses a kit and a method for rapidly identifying the sex of the macrobrachium rosenbergii, which have short time consumption and accurate detection results. The invention finally discloses application of the primer, the kit and the method in the aspect of breeding of the giant freshwater shrimps in the whole female or the whole male mode. The two patents respectively disclose molecular markers for genetic sex identification of macrobrachium rosenbergii, however, in practice, the markers are found to be unstable or are not suitable for all geographical populations of macrobrachium rosenbergii. Disclosure of Invention Aiming at the defects of the prior art, the invention provides a specific molecular marking method for identifying the genetic sex of macrobrachium rosenbergii and application thereof, and solves the problems that the marking has instability or is not suitable for all geographical groups of macrobrachium rosenbergii. The invention aims at realizing the purposes by adopting the following technical scheme that the specific molecular mar