Search

CN-121975931-A - Application of serum tRFs as HBV related liver injury diagnostic marker

CN121975931ACN 121975931 ACN121975931 ACN 121975931ACN-121975931-A

Abstract

The invention relates to the technical field of biological molecular diagnosis of hepatitis B related diseases, and particularly discloses a group of HBV related liver injury diagnosis markers and application thereof. The tRFs marker is any one or combined tRFs combination detection of the sequences, has the index advantages of high AUC value, high sensitivity and strong specificity, can solve the problem of early accurate diagnosis difficulty of hepatitis B related slow-plus acute liver failure (HBV-ACLF) caused by purely depending on traditional biochemical and blood coagulation indexes, and meets various diagnosis requirements including ACLF, chronic hepatitis B and cirrhosis.

Inventors

  • YU MINGXUE
  • ZHAO QIYI

Assignees

  • 中山大学
  • 中山大学附属第三医院

Dates

Publication Date
20260505
Application Date
20251229

Claims (10)

  1. 1. Use of a reagent for quantitatively detecting a marker tRFs in the preparation of a diagnostic product for HBV-related liver injury, wherein the marker tRFs comprises tRF-Val-TAC, tRF-Lys-CTT and/or tRF-Lys-TTT, and has the sequence: tRF-Val-TAC:CTTAACTTGACCGCTCTGACCA;tRF-Lys-CTT:AGTCGGTAGAGCATG;tRF-Lys-TTT:AGTCGGTAGAGCATGAGA。
  2. 2. the use according to claim 1, wherein said HBV-associated liver injury comprises a hepatitis b-associated chronic acute liver failure, chronic hepatitis b and/or cirrhosis.
  3. 3. The use of claim 1, wherein the marker tRFs is located in serum and a single peripheral blood sample is no more than 5 mL.
  4. 4. The use according to claim 1, wherein the reagent for quantitatively detecting the marker tRFs comprises at least one of the following primers ：tRF-Val-TAC-RT、tRF-Val-TAC-qFw、tRF-Lys-CTT-RT、tRF-Lys-CTT-qFw、tRF-Lys-TTT-RT、tRF-Lys-TTT-qFw、cel-miR-39-3p-RT、cel-miR-39-3p-qFw and universal-tRF-qRe, the sequences of which are shown in Seq No. 4-12.
  5. 5. The use according to claim 1, wherein the expression level calculation method of tRFs is ΔΔct relative quantification method.
  6. 6. The use according to claim 1, wherein the expression level of the marker tRFs is up-regulated.
  7. 7. The use according to claim 6, wherein the expression levels of tRF-Val-TAC, tRF-Lys-CTT and tRF-Lys-TTT are up-regulated.
  8. 8. A diagnostic product is characterized by comprising at least one of the following primers ：tRF-Val-TAC-RT、tRF-Val-TAC-qFw、tRF-Lys-CTT-RT、tRF-Lys-CTT-qFw、tRF-Lys-TTT-RT、tRF-Lys-TTT-qFw、cel-miR-39-3p-RT、cel-miR-39-3p-qFw and universal-tRF-qRe, wherein the sequences of the primers are shown as SEQ NO. 4-12.
  9. 9. The kit is characterized by comprising at least one of the following primers ：tRF-Val-TAC-RT、tRF-Val-TAC-qFw、tRF-Lys-CTT-RT、tRF-Lys-CTT-qFw、tRF-Lys-TTT-RT、tRF-Lys-TTT-qFw、cel-miR-39-3p-RT、cel-miR-39-3p-qFw and universal-tRF-qRe, wherein the sequences of the primers are shown as SEQ NO. 4-12.
  10. 10. Use of a kit according to claim 9 for modulating tRFs a related signal pathway.

Description

Application of serum tRFs as HBV related liver injury diagnostic marker Technical Field The invention relates to the field of diagnosis of hepatitis B related diseases, in particular to a group of serum tRFs serving as a diagnosis marker of HBV related liver injury and application thereof. Background Hepatitis b virus-associated slow-plus-acute liver failure (HBV-ACLF) is a terminal liver disease of chronic viral hepatitis b (CHB) patient in disease progression, with high mortality and severe life threatening. HBV-ACLF is urgent and complex, and its early diagnosis faces a great challenge due to the lack of specific clinical symptoms and reliable biomarkers. Currently, liver function detection indexes are mainly relied on, including serum bilirubin increase, prothrombin Time (PT) prolongation, international standardization ratio (INR) increase and albumin level decrease. However, these traditional detection indicators have insufficient sensitivity to early ACLF, often resulting in patients being diagnosed when the disease progresses to a more advanced stage. TRNA-derived small RNAs (tsRNAs) are generated by cleavage at specific sites of a transfer RNA (tRNA) or its precursor (pre-tRNA) and can be further divided into various subtypes, tRNA-derived fragments (tRFs) and tRNA halves. Notably, there was no correlation between the expression levels of tsRNAs and their source tRNA, suggesting that they are not random degradation products of tRNA, but rather small non-coding RNA produced by fertilization. And studies have demonstrated that tRFs is involved in regulating multiple stages of gene expression, including transcription, translation, and processing and maturation of RNA, while they are also closely related to critical functions such as self-renewal, differentiation, and proliferation within cells. One of the major advantages of tRFs as a biomarker in the field of disease diagnosis is its extremely high stability in biological fluids, which makes it an ideal choice for non-invasive diagnosis in the field of liver disease. Currently, studies on tRFs have focused mainly on tumorigenesis and genetic metabolism of sperm. However, the role of tRFs in HBV-associated liver injury, especially in HBV-ACLF, has been studied freshly. Disclosure of Invention The invention aims to overcome at least one of the defects in the prior art, provides application of a group of serum tRFs as a diagnostic marker of HBV-related liver injury, can be used as a novel diagnostic marker in tRFs combination, solves the problem of difficult early and accurate diagnosis of ACLF caused by purely relying on traditional biochemical and blood coagulation indexes, and meets various diagnostic requirements including ACLF, chronic hepatitis B and liver cirrhosis. The technical scheme adopted by the invention is that the application of a reagent for quantitatively detecting a marker tRFs in preparing HBV related liver injury diagnostic products is provided, wherein the marker tRFs comprises tRF-Val-TAC, tRF-Lys-CTT and/or tRF-Lys-TTT, and the sequence is as follows: tRF-Val-TAC:CTTAACTTGACCGCTCTGACCA; tRF-Lys-CTT:AGTCGGTAGAGCATG; tRF-Lys-TTT:AGTCGGTAGAGCATGAGA。 Further, the HBV-associated liver injury includes hepatitis b-associated chronic acute liver failure, chronic hepatitis b, and/or cirrhosis. In one or more embodiments of the invention, tRFs associated with HBV-ACLF was identified by tRFs sequencing technology, differential expression tRFs was validated in independent cohorts, 3 tRFs (tRF-Val-TAC, tRF-Lys-CTT and tRF-Lys-TTT) were screened by LASO model, and the area under the curve (AUC) analyzed by subject working characteristics (ROC) curve, the application value of these biomarkers for ACLF diagnosis was evaluated, and the results showed that three tRFs of tRF-Val-TAC, tRF-Lys-CTT and tRF-Lys-TTT exhibited specific upregulation in serum of patients with chronic acute liver failure (ACLF), each of these three tRFs had excellent diagnostic performance for three HBV-associated liver lesions (chronic hepatitis B, cirrhosis, ACLF), and the combined application of these three tRFs exhibited higher diagnostic efficacy for three HBV-associated liver lesions. Further, the marker tRFs is located in serum and a single peripheral blood sample does not exceed 5 mL. Further, the reagent for quantitatively detecting the marker tRFs comprises at least one of the following primers ：tRF-Val-TAC-RT、tRF-Val-TAC-qFw、tRF-Lys-CTT-RT、tRF-Lys-CTT-qFw、tRF-Lys-TTT-RT、tRF-Lys-TTT-qFw、cel-miR-39-3p-RT、cel-miR-39-3p-qFw and universal-tRF-qRe, and the sequences of the primers are shown as SEQ NO. 4-12. Among the above primers, the first 6 primers are 3 forward and reverse primers tRFs, the cel-miR-39-3p-RT and cel-miR-39-3p-qFw are forward and reverse primers of a tRFs expression quantity reference cel-miR-39, and the universal-tRF-qRe is a universal reverse primer. Further, the expression amount calculation method of tRFs is a ΔΔct relative quantification method.