Search

CN-121975943-A - Differential primer and probe-based rapid identification system for RPA and TAQMAN QPCR double-path length Lin Xiaodu, primer and kit

CN121975943ACN 121975943 ACN121975943 ACN 121975943ACN-121975943-A

Abstract

The invention belongs to the technical field of biological detection and animal and plant quarantine, and particularly relates to an RPA/RAA-LFS and TAQMAN QPCR double-path length Lin Xiaodu rapid identification system, a primer and a kit based on differential primers and probes. The invention takes mitochondrial ND2 gene fragment as a detection target, adopts a specific primer pair and a specific site to introduce a lock nucleic acid modification structure probe so as to realize a quantitative path for RPA field detection, and establishes a laboratory quantitative detection path based on real-time fluorescence quantitative PCR (qPCR). The primers and the probes obtained by screening can effectively distinguish near-edge or non-target species such as long Lin Xiaodu and red bark beetle, ophraella communa, brown foot horned thorn leaf beetle and the like. The system realizes the unification of RPA-LFS field signal quantification and laboratory dual-path detection, provides a high-efficiency and accurate molecular detection technology for port quarantine, forestry pest monitoring and invasive species emergency prevention and control, and has remarkable popularization and application values.

Inventors

  • SONG XUEMEI
  • CAO YUHAO
  • WANG JIAYING
  • CHEN JIAOJIAO
  • CUI JUNXIA
  • LIU LI
  • CHEN XIANFENG
  • YI ZHIGANG

Assignees

  • 宁波大学
  • 宁波海关技术中心
  • 杭州大鱼探柯生物科技有限公司

Dates

Publication Date
20260505
Application Date
20251220

Claims (10)

  1. 1. The detection method according to claim 2, wherein the method uses an insect rough crack rapid identification system based on differential primer and Probe RPA and TAQMAN QPCR double-path length Lin Xiaodu, and the identification system comprises an on-site rapid detection system based on RPA/RAA-LFS and a laboratory quantitative detection system based on TAQMAN QPCR, wherein the on-site rapid detection system based on RPA/RAA-LFS uses an insect rough lysate as a template, carries out recombinase polymerase amplification or recombinase assisted amplification (RPA/RAA) through a specific primer pair and a Probe, judges that a long Lin Xiaodu exists in a sample through a lateral chromatography test strip, a forward primer in the primer pair of RPA/RAA amplification is CLXD-F2-28, the sequence is shown as SEQ ID NO.18, a reverse primer is CLXD-R2-28, the sequence is shown as SEQ ID NO.19, a Probe is a Probe-24-7 modified with a locked nucleic acid, the sequence is shown as SEQ ID NO.17, and the forward primer in the primer pair of RPA/RAA amplification is CLXD-F2-28, the sequence is shown as SEQ ID NO.18, and the reverse primer pair of the sequence is shown as SEQ ID NO. 24-6224-R2-28.
  2. 2. A detection method of a long Lin Xiaodu (Hylurgus ligniperda) based on recombinase polymerase amplification or recombinase-assisted amplification and lateral chromatography test strips (RPA/RAA-LFS) is characterized in that a mitochondrial ND2 gene fragment is used as a target, a specific primer group with asymmetric length and concentration and a Probe modified by a locked nucleic acid for modifying a specific site are adopted for detection, wherein a forward primer in the primer group is CLXD-F2-28, the sequence is shown as SEQ ID NO.18, a reverse primer is CLXD-R2-28, the sequence is shown as SEQ ID NO.19, and the sequence of the Probe-24-7 modified by the locked nucleic acid is shown as SEQ ID NO. 17.
  3. 3. The method according to claim 2, wherein the concentration ratio of the forward primer to the probe to the reverse primer is 1:0.286:1.429.
  4. 4. The solution is used as a template, nucleic acid extraction is not needed, amplification is carried out for 14 minutes at 39 ℃, signals are read through a quantum dot fluorescence lateral chromatography test strip (LFS), and the copy number of the target gene is obtained according to the fluorescence intensity of the detection line and the standard curve fitting, so that the on-site quantitative detection can be realized.
  5. 5. A real-time fluorescence quantitative PCR (qPCR) based long Lin Xiaodu detection method is characterized by comprising the steps of using a forward primer CLXD-F2-24 in a TaqMan system, wherein the sequence of the forward primer is shown as SEQ ID NO.7, using a reverse primer-R2-24, the sequence of the reverse primer-R2-24 is shown as SEQ ID NO.8, and using an LNA modified TaqMan probe P GAAGTTATTAATTAGGTTGA (SEQ ID NO. 32) to accurately quantify a crude lysate sample.
  6. 6. The RPA/RAA-LFS composition is characterized by comprising a specific forward primer pair, a reverse primer pair, a locked nucleic acid modified Probe, a buffer solution and an enzyme preparation required by RPA or RPA amplification, a quantum dot fluorescence LFS test strip and a standard curve reference substance, wherein the forward primer of the primer pair is CLXD-F2-28, the sequence is shown as SEQ ID NO.18, the reverse primer is CLXD-R2-28, the sequence is shown as SEQ ID NO.19, and the sequence of the locked nucleic acid modified Probe-24-7 is shown as SEQ ID NO. 17.
  7. 7. A qPCR amplification composition is characterized by comprising a primer pair, a buffer solution and an enzyme preparation, wherein the buffer solution and the enzyme preparation are required by qPCR, the forward primer CLXD-F2-24 of the primer pair are shown in SEQ ID NO.7, the reverse primer-R2-24 are shown in SEQ ID NO.8, and when the qPCR amplification method is TAQMAN QPCR, the composition further comprises a probe modified by locked nucleic acid shown in SEQ ID NO. 17.
  8. 8. A kit for length Lin Xiaodu detection, comprising the RPA/RAA-LFS composition of claim 6 and the qPCR amplification composition of claim 7.
  9. 9. The detection method of claim 2 or the application of the detection method of claim 5 in site rapid detection or laboratory quantitative detection of port quarantine, forestry quarantine, pest monitoring and emergency prevention and control center length Lin Xiaodu.
  10. 10. Use of the RPA/RAA-LFS composition of claim 6, or the qPCR amplification composition of claim 7, in the on-site rapid detection or laboratory quantitative detection of a length Lin Xiaodu in port quarantine, forestry quarantine, pest monitoring, emergency control.

Description

Differential primer and probe-based rapid identification system for RPA and TAQMAN QPCR double-path length Lin Xiaodu, primer and kit Technical Field The invention relates to the technical field of biological detection, in particular to a rapid identification system, a primer and a kit for RPA and TAQMAN QPCR double-path length Lin Xiaodu based on differential primers and probes. Background Length Lin Xiaodu (Hylurgus ligniperda) is Coleoptera (Coleoptera), bark beetle family (Scolytidae), lin Xiaodu genus (Hylurgus) insects which mainly inhabit between the inner layer and xylem of the tree, and the hatched larvae and adults destroy the moisture and nutrient transport system of the tree by eating, seriously affect the normal growth of the tree, and further lead to withering or death of the tree. In addition, the long-forest bark beetles can carry various microorganisms and nematodes to cause secondary plant diseases or destructive hazards, and form a great threat to forest ecosystems. The long Lin Xiaodu suitable area is wide, the flying capability of adults is strong, the insect is one of invasive forest insects with the highest transmission speed, and important economic tree species such as pine and the like are seriously damaged, so that the global forestry production has great economic loss. The quick and accurate identification of the length Lin Xiaodu is a key precondition for realizing effective quarantine and intrusion prevention and control. The existing detection means mainly depend on morphological identification, and have the defects of time and labor waste, dependence on expert experience and difficulty in identifying larva samples. In recent years, a molecular detection method is introduced into quarantine detection, but a common PCR or qPCR method needs laboratory conditions and is not suitable for field use, and the RPA/RAA method provided by the prior CN117144022A has the problems of insufficient specificity and low detection sensitivity. Therefore, developing a high-efficiency and sensitive detection technology with both field rapid detection capability and laboratory quantitative detection capability, especially a detection method suitable for high-sensitivity quantitative analysis of trace-level samples in field laboratories, has become an urgent need for long Lin Xiaodu prevention and control. The research and development of the corresponding technology not only can provide technical support for early port monitoring of the length Lin Xiaodu, but also can effectively reduce economic and ecological losses caused by invasion of the long port monitoring, and has important practical significance. Disclosure of Invention The invention aims to solve the problems of insufficient specificity, low detection sensitivity, cleavage of a laboratory and field detection system and the like of the existing long Lin Xiaodu detection method, and provides a dual-path molecular detection system. The system can realize rapid detection on the port and forestry site, and can perform high-sensitivity quantitative analysis of trace samples under laboratory conditions, thereby improving the efficiency and accuracy of long Lin Xiaodu quarantine detection. In order to achieve the purpose, the technical scheme provided by the invention is as follows: The invention discloses a detection method of a long Lin Xiaodu (H. ligniperda) based on recombinase polymerase amplification or recombinase-assisted amplification and lateral chromatography test paper strips (RPA/RAA-LFS), which adopts a mitochondrial ND2 gene fragment as a target, adopts a specific primer group with asymmetric length and concentration and a Probe modified by a locked nucleic acid for modifying a specific site to detect, wherein the forward primer in the primer group is CLXD-F2-28, the sequence is shown as SEQ ID NO.18, the reverse primer is CLXD-R2-28, the sequence is shown as SEQ ID NO.19, and the sequence of the Probe modified by the locked nucleic acid is shown as SEQ ID NO. 17. In one embodiment, the concentration ratio of forward primer to probe to reverse primer is 1:0.286:1.429. The detection method of the long Lin Xiaodu (H. ligniperda) based on recombinase polymerase amplification or recombinase-assisted amplification and lateral chromatography test strips (RPA/RAA-LFS) can distinguish the long Lin Xiaodu from the red bark beetles, southern pine bark beetles, red wing bark beetles, guangdong leaf beetles, brown foot horned leaf beetles, corn root beetles, huang Zhitiao flea beetles, rape flea beetles, medlar negative mud beetles, solenopsis invicta and other non-target species. According to the test method based on the recombinase polymerase amplification or the recombinase-assisted amplification and the lateral chromatography test strip, the insect crude lysate is used as a template, nucleic acid extraction is not needed, amplification is carried out for 14 minutes at 39 ℃, signals are read through a quantum dot fluorescence lateral chromat