Search

CN-121975947-A - SSR primer group for analysis of genetic diversity and identification of kindred relationship of hyriopsis cumingii, and acquisition method and application thereof

CN121975947ACN 121975947 ACN121975947 ACN 121975947ACN-121975947-A

Abstract

The invention provides an SSR primer group for analysis of genetic diversity and identification of kindred relationship of hyriopsis cumingii, an acquisition method and application thereof, belonging to the technical field of DNA molecular markers, the SSR molecular marker primer composition for hyriopsis cumingii provided by the invention comprises at least 1 pair of 24 pairs of primers, the nucleotide sequence of the 24 pairs of primers is shown as SEQ ID No.1-SEQ ID No.48, the SSR core primer group provided by the invention is uniformly distributed in the genome of the hyriopsis cumingii, has high polymorphism, good amplification repeatability, clear band and easy interpretation, is suitable for detection by a capillary fluorescent detection platform, and can be applied to identification, genetic diversity analysis, population genetic structure, genetic relationship identification and the like of the hyriopsis cumingii.

Inventors

  • JIANG MIN
  • XIE LINGLI
  • LIU KAI
  • LIU TENGTENG
  • Wen Lujie

Assignees

  • 中国水产科学研究院淡水渔业研究中心

Dates

Publication Date
20260505
Application Date
20260213

Claims (10)

  1. 1. The SSR primer group for the analysis of the genetic diversity of the hyriopsis cumingii and the identification of the kindred relation is characterized in that the nucleotide sequences of 24 pairs of primers of the SSR primer group for the analysis of the genetic diversity of the hyriopsis cumingii and the identification of the kindred relation are shown as SEQ ID No.1-SEQ ID No. 48; The upstream primer of SSR001 is shown as SEQ ID No.1: AGGTGCCATGATTTGTCCTGT, and the downstream primer is shown as SEQ ID No.2: ACCGCTTGTCTTCCTCTGTT; The upstream primer of SSR003 is shown as SEQ ID No.3: TCTGTGCTTCTTACTTAAGATGGCT, and the downstream primer is shown as SEQ ID No.4: TCACTGTACACACACACAAACC; The upstream primer of SSR004 is shown as SEQ ID No.5: CCCAGTGCTTGACGTCACTA, and the downstream primer is shown as SEQ ID No.6: CTGACTGAAAGAAGAAAAGTGGCA; The SSR008 upstream primer is shown as SEQ ID No.7: AGTAATCGGCTTGGCATGGT, the downstream primer is shown as SEQ ID No.8: AAGCATGTGCAGTTAACGCG; The upstream primer of SSR015 is shown as SEQ ID No.9: GTGGACAGAGGTGATCCGTG, and the downstream primer is shown as SEQ ID No.10: GCCACACTGCAGACATCGTA; The SSR024 upstream primer is shown as SEQ ID No.11: TCGATACTTGTTATACCTAACGGGA, the downstream primer is shown as SEQ ID No.12: AGATTGGTCTGGTTGCCAAAA; The upstream primer of SSR026 is shown as SEQ ID No.13: CAAGCCGGCATCCGCTATAT, and the downstream primer is shown as SEQ ID No.14: AAAACGAAAGAAATTAGCCTTGCA; The upstream primer of SSR027 is shown as SEQ ID No.15: TTTCGACTGCAAGAACAGACTT, and the downstream primer is shown as SEQ ID No.16: GCACTCTACAACATTGGACAACA; The upstream primer of SSR031 is shown as SEQ ID No.17: TGAGGGAGAGAGAGGCAACA, and the downstream primer is shown as SEQ ID No.18: GGCTGGATATGAGTCGGGTG; The upstream primer of SSR032 is shown as SEQ ID No.19: AGTCGCGTGCTCTAACCATT, and the downstream primer is shown as SEQ ID No.20: ACAGTGGAAGCGGAGATTGG; the upstream primer of SSR036 is shown as SEQ ID No.21: GTCTGCGGCATGATTACACC, and the downstream primer is shown as SEQ ID No.22: CATTTTTGGACGTGCGTGGA; the upstream primer of SSR037 is shown as SEQ ID No.23: GCGCCAGGTGTCTAACATCA, and the downstream primer is shown as SEQ ID No.24: GGAGGCTATTCAAGAATACGTTGC; the SSR050 upstream primer is shown as SEQ ID No.25: AGTGCTGGAATACTCTATGGGT, and the SSR050 downstream primer is shown as SEQ ID No.26: ACAACCGCATTGCAAATGGG; the upstream primer of SSR054 is shown as SEQ ID No.27: TAGCTCGCTGAACAACCCAC, and the downstream primer is shown as SEQ ID No.28: GTGGCAAGGGCTAGAGGAAC; The upstream primer of SSR056 is shown as SEQ ID No.29: CAGCAGCTGTCAACGCAAAT, and the downstream primer is shown as SEQ ID No.30: GCTTCTGGTTCAAAGTTCTTCACA; the upstream primer of SSR059 is shown as SEQ ID No.31: AGCACAAATACGGTGGCTCA, and the downstream primer is shown as SEQ ID No.32: AGACTCCGTGAGAATCGAAAGT; SSR062 upstream primer shown as SEQ ID No.33: GAGCTCCGCCACAGTAAGAA, downstream primer shown as SEQ ID No.34: TTAAAAGTCCAACGCTCGCC; The upstream primer of SSR066 is shown as SEQ ID No.35: CAGCTCTGCCAACTCTGACA, and the downstream primer is shown as SEQ ID No.36: TCTTCCTCAGGCATTCGTGG; the upstream primer of SSR071 is shown as SEQ ID No.37: ACGAAAGCACCCTTCGAGAG, and the downstream primer is shown as SEQ ID No.38: GGGCGGCATGGATAACAGAT; The upstream primer of SSR084 is shown as SEQ ID No.39: CCCTCCTCTTCGCCGAAAAT, and the downstream primer is shown as SEQ ID No.40: TGGGATGATGATGCTGTTGGT; the upstream primer of SSR086 is shown as SEQ ID No.41: GCCCTAGTGCCAGACATCAC, and the downstream primer is shown as SEQ ID No.42: TGACATACATACGGGTCAGTCC; the upstream primer of SSR101 is shown as SEQ ID No.43: TCTGGCTCTATCTGCTTGGT, and the downstream primer is shown as SEQ ID No.44: CAAAATGAGGGATTGTCTTGTGT; The upstream primer of SSR108 is shown as SEQ ID No.45: CGTGTTCCTTGGGACGTTCT, and the downstream primer is shown as SEQ ID No.46: GGAGTGCTCCGTTCTTGGAA; The upstream primer of SSR123 is shown as SEQ ID No.47: GCGAATCGGACGACTTGTTC, and the downstream primer is shown as SEQ ID No.48: CGGCGCGCATAAAACGTATT.
  2. 2. Use of the SSR primer set for analysis of genetic diversity and identification of kinship of hyriopsis cumingii according to claim 1 in analysis of genetic structure and genetic diversity of hyriopsis cumingii.
  3. 3. The use according to claim 2, characterized by the steps of: Step one, extracting genomic DNA of the hyriopsis cumingii by using a kit; step two, taking the extracted genomic DNA of the hyriopsis cumingii as a template, carrying out PCR reaction by using the primers SEQ ID NO. 1-SEQ ID NO.48, and detecting a PCR product; step three, typing the PCR product amplified in the step two; and step four, carrying out data analysis on the parting result obtained in the step three so as to realize analysis of genetic structure and genetic diversity.
  4. 4. The method according to claim 3, wherein the PCR amplification reaction system in the second step comprises 1. Mu.L of the first template DNA, 1. Mu.L of the 10. Mu.M forward primer, 1. Mu.L of the 10. Mu.M reverse primer, 17. Mu.L of the Prinsepia gold Mix (green), and the second amplification reaction is carried out by amplifying the first template DNA with the fluorescence-modified adaptor primer and the reverse primer.
  5. 5. The method of claim 3, wherein the PCR amplification is performed by pre-denaturing at 98℃for 2min, denaturing at 98℃for 10s, annealing at the annealing temperature of each primer pair for 10s, extending at 72℃for 10s for 35 cycles, and terminating the reaction at 4℃after extending at 72℃for 5 min.
  6. 6. The use according to claim 3, wherein in step three the amplified PCR products are typed by capillary electrophoresis.
  7. 7. The method according to claim 3, wherein in the fourth step, the typing result obtained in the third step is subjected to data analysis by using bioinformatics software.
  8. 8. A method of obtaining the SSR primer set for analysis of genetic diversity and identification of kinship of hyriopsis cumingii according to claim 1, comprising the steps of: Firstly, obtaining SSR molecular markers of the hyriopsis cumingii, namely obtaining a plurality of microsatellite markers through a high-quality chromosome level genome of the hyriopsis cumingii; Extracting genomic DNA of the hyriopsis cumingii sample by adopting QIAGEN DNEASY Blood & Tissue kit; Thirdly, screening polymorphic microsatellite molecular markers, namely randomly selecting 163 sites from 1020114 microsatellite sites as candidate microsatellite molecular markers according to a principle of uniform distribution on a chromosome, designing primers by using Primer 5.0 software aiming at 500.0 interval sequences of the upstream and downstream of the 163 microsatellite sites, extracting genome DNA of a hyriopsis cumingii sample as a template, respectively carrying out PCR amplification by using 163 primers, initially screening and retaining 136 microsatellite sites with polymorphism, modifying the 5' end of the corresponding forward primers of the 136 microsatellite sites with polymorphism, synthesizing fluorescent primers again, carrying out PCR amplification by using the modified forward primers and the corresponding reverse primers by using the genome DNA of the hyriopsis cumingii sample as a template, and finally screening 24 microsatellite sites with stable amplification effect, high polymorphism and low genotyping error rate.
  9. 9. The method for obtaining SSR primer set for analysis of genetic diversity and identification of kindred relation of hyriopsis cumingii according to claim 8, wherein the first step is specifically based on chromosome level genome data of hyriopsis cumingii, and 1020114 microsatellite locus data are obtained by using TRF 4.09 software.
  10. 10. The method for obtaining the SSR primer set for analysis of genetic diversity and identification of kindred relationship of hyriopsis cumingii according to claim 8, wherein the 5' end in the third step is modified with one or more of fluorophores FAM, ROX, HEX.

Description

SSR primer group for analysis of genetic diversity and identification of kindred relationship of hyriopsis cumingii, and acquisition method and application thereof Technical Field The invention relates to the technical field of DNA molecular markers, in particular to an SSR primer group for analysis of genetic diversity and identification of kindred relationship of hyriopsis cumingii, and an acquisition method and application thereof. Background The hyriopsis cumingii is a special rare fresh water bivalve species in China, has unique germplasm background and important ecological functions, is influenced by factors such as artificial interference, habitat fragmentation, small population effect and the like, the wild population quantity of the hyriopsis cumingii is continuously reduced, the genetic diversity change trend is unknown, and germplasm resources can be subjected to irreversible loss. Under the background, the system develops the research of germ plasm resources, genetic structure analysis and population recovery strategy, and has very important theoretical significance and practical value for protecting the diversity of special freshwater shellfish and promoting the sustainable utilization of freshwater biological resources. In particular, in species ecological protection, accurate evaluation of genetic diversity is an important basis for judging population health conditions, identifying genetic bottlenecks and formulating protection grades, and in the proliferation and releasing and field population reconstruction processes, the development of genetic relationship identification can effectively avoid inbreeding, improve genetic quality and adaptability of releasing populations, and has a key meaning for freshwater shellfish recovery. Accurate evaluation of genetic background is the basis for developing all protection and breeding work. In the molecular marker technology, SSR markers are recognized as one of the most effective tools for genetic analysis because of the advantages of co-dominant inheritance, high polymorphism, good repeatability, wide distribution in genome, easy detection and the like. Currently, for genetic studies of hyriopsis cumingii, available SSR markers mainly originate from two approaches, namely, transfer from a near-edge species and attempt to perform cross-species amplification by using SSR primers developed from other hyriopsis cumingii and the like. The students use 8 pairs of primers with higher polymorphism screened by the two fresh water bivalve species in North America and in Central Europe, and use the 8 microsatellite loci to analyze genetic diversity of 5 mussel populations such as cave mussels. However, this method has problems such as poor versatility, low polymorphism, low success rate, and the like, and it is difficult to obtain a stable and informative label. Secondly, the traditional genome library is developed, and SSR markers are developed through traditional methods such as genome library construction, hybridization screening and the like. The method has the advantages of complicated flow, long period, high cost, limited number of obtained markers and incapability of covering the genome in whole. The above techniques still have some drawbacks, mainly represented by the limited number of markers, and difficulty in obtaining SSR markers in sufficient number and covering the whole genome, thus limiting the construction of high-density genetic maps and fine genetic analysis. Meanwhile, polymorphism and stability are poor, primer specificity is insufficient during trans-species transfer, amplification efficiency is low and unstable, and experimental results lack of reliability. In addition, the development efficiency is low, the traditional method is time-consuming, labor-consuming and high in cost, and the intensive research on the specific species of the cave hyriopsis schlegeli is severely restricted. With the rapid development of high throughput sequencing technologies, it has become possible to develop SSR markers based on whole genome sequencing information. The method can rapidly discover SSR sites from the whole genome level in batches, and designs primers with strong specificity and uniform coverage. However, up to now, no relevant report or patent publication has been made on the basis of the development of SSR primer sets from the whole genome of the hyriopsis cumingii. Therefore, a set of SSR primer groups for analysis of genetic diversity and identification of kindred relationship and with high polymorphism and species specificity are urgently needed in the field so as to solve the bottleneck problem in the prior art and provide powerful technical support for germplasm resource protection, genetic diversity assessment, genetic relationship analysis, proliferation and release guidance, genetic breeding and molecular biology research of the hyriopsis cumingii. Disclosure of Invention The invention aims to provide an SSR primer group for analysis of