CN-121975948-A - SNP molecular marker related to sperm ATP concentration of breeding rabbits and application thereof
Abstract
The invention relates to an SNP molecular marker related to the ATP concentration of sperm of a breeding rabbit and application thereof, and the nucleotide sequence of the SNP molecular marker is shown as SEQ ID NO. 1. In the sequence, the 141 th base from the 5' end is a C/G polymorphic locus, and the sperm ATP concentration of the female rabbits with homozygous GG and heterozygous CG at the locus genotype is obviously higher than that of the female rabbits with homozygous CC at the locus genotype. The invention also provides a primer pair for detecting the SNP molecular marker, and application of the SNP molecular marker, the primer pair and the like in molecular marker assisted breeding of breeding rabbits. The invention firstly discovers SNP markers related to sperm energy metabolism in the local breeding rabbits in Fujian province, provides molecular basis for breeding the breeding rabbits, can rapidly screen individuals with high energy metabolism through early genotyping, and improves the artificial insemination breeding efficiency.
Inventors
- GAO CHENGFANG
- SANG LEI
- SUN SHIKUN
- CHEN DONGJIN
- WANG JINXIANG
- LIU MING
Assignees
- 福建省农业科学院畜牧兽医研究所
Dates
- Publication Date
- 20260505
- Application Date
- 20260302
Claims (8)
- 1. A SNP molecular marker related to the ATP concentration of sperm of a breeding rabbit is characterized in that the SNP molecular marker is positioned in the 1453 rd base domain of the 6 th intron of a rabbit mitochondrial complex I gene NDUFV2, the nucleotide sequence of the SNP molecular marker is shown as follows, the 141 th base from the 5' end in the nucleotide sequence of the SNP molecular marker is expressed by K, and K represents C or G, so that polymorphism is caused; 5'-TGAAAGGCAGAGTTAAAGAGATTCCCAATAGCCCAATAGCCAGTTAGGCCAGGCTGAAGCCAGGAGCTTCATCCAGGTTTCCCATGTGGATGGTAGGGACCCAAGCACTTGGGCCATCTTCTGCTGCTTTCCCAGGGGCGKTAGCAGGGGAGCTGGATCAGAAGTGGAAGAGCCACAACTTGAACCGACACCCATATGGGATGTTGGTGTTACAGGTCACAGCTTAACCCACTGTGCCACAATACTGGTCCCCTTCAGTGCTTTTCTTTTGGCTCACATTTCTTACAAATTGGCTTATGG-3'.
- 2. The SNP molecular marker according to claim 1, wherein K at 141 th base from 5' end in the nucleotide sequence of the SNP molecular marker is related to energy metabolism ability of fresh sperm of the breeding rabbits, and sperm ATP concentration of the breeding rabbits with the locus genotype of homozygous GG and heterozygous CG is significantly higher than sperm ATP concentration of the individual breeding rabbits with the genotype of homozygous CC.
- 3. A primer pair for detecting the SNP molecular marker as set forth in claim 1, characterized in that it comprises an upstream primer and a downstream primer, the nucleotide sequences of which are as follows: Upstream primer 5'-TCCCATGTGGATGGTAGGGA-3' and downstream primer 5'-TGGCACAGTGGGTTAAGCTG-3'.
- 4. A kit for detecting the SNP molecular marker as set forth in claim 1, characterized in that it comprises the primer set as set forth in claim 3.
- 5. A method for breeding or identifying a breeding rabbit having a high sperm ATP concentration by using the SNP molecular marker as set forth in claim 1, comprising the steps of: (1) Extracting genome DNA of a seed rabbit to be detected; (2) And carrying out PCR (polymerase chain reaction) amplification by using genomic DNA of a seed rabbit to be detected as a template and using an upstream primer and a downstream primer to obtain an amplification product, wherein the nucleotide sequences of the upstream primer and the downstream primer are as follows: an upstream primer 5'-TCCCATGTGGATGGTAGGGA-3' and a downstream primer 5'-TGGCACAGTGGGTTAAGCTG-3'; (3) Sequencing the amplified product to determine the genotype of the SNP molecular marker according to claim 1, wherein K at 141bp from the 5' end in the nucleotide sequence of the SNP molecular marker is related to the energy metabolism capability of fresh sperm of a breeding rabbit, and the sperm ATP content of the breeding rabbit with the locus genotype of homozygous GG and heterozygous CG is obviously higher than the sperm ATP concentration of an individual breeding rabbit with the genotype of homozygous CC.
- 6. The application of SNP molecular markers related to the ATP concentration of sperm of a breeding rabbit, primer pairs for detecting the SNP molecular markers or a kit containing the primer pairs in molecular marker assisted breeding of the breeding rabbit; Wherein the SNP molecular marker is positioned in the 1453 rd base domain of the 6 th intron of the rabbit mitochondrial complex I gene NDUFV2, the nucleotide sequence of the SNP molecular marker is shown as follows, the 141 th base from the 5' end in the nucleotide sequence of the SNP molecular marker is expressed by K, and K represents C or G, so that polymorphism is caused; 5'-TGAAAGGCAGAGTTAAAGAGATTCCCAATAGCCCAATAGCCAGTTAGGCCAGGCTGAAGCCAGGAGCTTCATCCAGGTTTCCCATGTGGATGGTAGGGACCCAAGCACTTGGGCCATCTTCTGCTGCTTTCCCAGGGGCGKTAGCAGGGGAGCTGGATCAGAAGTGGAAGAGCCACAACTTGAACCGACACCCATATGGGATGTTGGTGTTACAGGTCACAGCTTAACCCACTGTGCCACAATACTGGTCCCCTTCAGTGCTTTTCTTTTGGCTCACATTTCTTACAAATTGGCTTATGG-3'; The primer pair comprises an upstream primer and a downstream primer, and the nucleotide sequence of the primer pair is as follows: Upstream primer 5'-TCCCATGTGGATGGTAGGGA-3' and downstream primer 5'-TGGCACAGTGGGTTAAGCTG-3'.
- 7. The application of SNP molecular markers related to the ATP concentration of sperm of a breeding rabbit, primer pairs for detecting the SNP molecular markers or a kit containing the primer pairs in screening the breeding rabbit with high sperm energy metabolism capability; Wherein the SNP molecular marker is positioned in the 1453 rd base domain of the 6 th intron of the rabbit mitochondrial complex I gene NDUFV2, the nucleotide sequence of the SNP molecular marker is shown as follows, the 141 th base from the 5' end in the nucleotide sequence of the SNP molecular marker is expressed by K, and K represents C or G, so that polymorphism is caused; 5'-TGAAAGGCAGAGTTAAAGAGATTCCCAATAGCCCAATAGCCAGTTAGGCCAGGCTGAAGCCAGGAGCTTCATCCAGGTTTCCCATGTGGATGGTAGGGACCCAAGCACTTGGGCCATCTTCTGCTGCTTTCCCAGGGGCGKTAGCAGGGGAGCTGGATCAGAAGTGGAAGAGCCACAACTTGAACCGACACCCATATGGGATGTTGGTGTTACAGGTCACAGCTTAACCCACTGTGCCACAATACTGGTCCCCTTCAGTGCTTTTCTTTTGGCTCACATTTCTTACAAATTGGCTTATGG-3'; The primer pair comprises an upstream primer and a downstream primer, and the nucleotide sequence of the primer pair is as follows: Upstream primer 5'-TCCCATGTGGATGGTAGGGA-3' and downstream primer 5'-TGGCACAGTGGGTTAAGCTG-3'.
- 8. The application of SNP molecular markers related to the ATP concentration of sperm of the breeding rabbits, primer pairs for detecting the SNP molecular markers or a kit containing the primer pairs in auxiliary evaluation of the reproductive capacity of the breeding rabbits; Wherein the SNP molecular marker is positioned in the 1453 rd base domain of the 6 th intron of the rabbit mitochondrial complex I gene NDUFV2, the nucleotide sequence of the SNP molecular marker is shown as follows, the 141 th base from the 5' end in the nucleotide sequence of the SNP molecular marker is expressed by K, and K represents C or G, so that polymorphism is caused; 5'-TGAAAGGCAGAGTTAAAGAGATTCCCAATAGCCCAATAGCCAGTTAGGCCAGGCTGAAGCCAGGAGCTTCATCCAGGTTTCCCATGTGGATGGTAGGGACCCAAGCACTTGGGCCATCTTCTGCTGCTTTCCCAGGGGCGKTAGCAGGGGAGCTGGATCAGAAGTGGAAGAGCCACAACTTGAACCGACACCCATATGGGATGTTGGTGTTACAGGTCACAGCTTAACCCACTGTGCCACAATACTGGTCCCCTTCAGTGCTTTTCTTTTGGCTCACATTTCTTACAAATTGGCTTATGG-3'; The primer pair comprises an upstream primer and a downstream primer, and the nucleotide sequence of the primer pair is as follows: Upstream primer 5'-TCCCATGTGGATGGTAGGGA-3' and downstream primer 5'-TGGCACAGTGGGTTAAGCTG-3'.
Description
SNP molecular marker related to sperm ATP concentration of breeding rabbits and application thereof Technical Field The invention belongs to the technical field of animal molecular genetics and auxiliary breeding, and particularly relates to an SNP molecular marker related to the ATP concentration of sperm of a breeding rabbit and application thereof. Background Sperm energy metabolism is primarily dependent on two major pathways, mitochondrial oxidative phosphorylation and glycolysis. Mitochondrial complex I (NADH dehydrogenase) is one of the key enzymes in oxidative phosphorylation systems, whose activity directly regulates ATP production efficiency. Studies have shown that the variation of the genes involved in encoding the functional subunits of the complex may be related to individual differences in sperm energy metabolism. The Fujian local rabbit species (such as Fujian yellow rabbits, fujian southwest black rabbits and Fujian white rabbits) have the characteristics of strong adaptability, coarse feeding resistance, good meat quality and the like, and are important local genetic resources. With the expansion of cultivation scale, particularly in large-scale farms, artificial insemination has become a key technology for improving reproductive efficiency. The success of artificial insemination is highly dependent on sperm motility, while ATP acts as a core energy carrier for sperm motility and function, the concentration of which is closely related to mitochondrial oxidative phosphorylation efficiency. Low ATP concentrations often result in insufficient sperm energy supply, reduced motility, while high ATP levels generally correspond to higher sperm motility. The compound I is used as an initiation and speed-limiting link of an oxidative phosphorylation pathway and plays a dominant regulatory role in ATP generation. In recent years, it has been found that the genetic variation of the nuclear gene NDUFV2 encoding the core catalytic subunit of the complex affects the assembly and enzymatic activity of the complex, and thus interferes with the energy metabolism process of sperm mitochondria, and is associated with male reproductive dysfunction. Therefore, if DNA molecular markers are developed based on NDUFV2 genes, the rapid identification of the ATP concentration of sperms is realized, and the method is helpful for promoting the efficient breeding of male animals. The technology not only can provide molecular basis for screening high-fertility breeding rabbits in breeding, but also provides a potential technical path for improving male reproductive performance through a gene regulation means. By predicting the sperm ATP levels of different local rabbit varieties, the sperm motility can be further predicted, so that the breeding efficiency of the breeding rabbits is systematically improved. Disclosure of Invention The invention aims to provide an SNP molecular marker related to the ATP concentration of sperm of a breeding rabbit and application thereof, which are used for early breeding the breeding rabbit with high energy metabolism capability and improving sperm motility. The aim of the invention is realized by the following technical scheme: In order to realize the invention, the correlation between the molecular marker and the sperm energy metabolism phenotype is determined by measuring the sperm ATP concentration and detecting the specific SNP molecular marker of the breeding rabbits by combining a gene sequencing technology, and further carrying out correlation analysis on the SNP genotype and the sperm ATP level. The method comprises the following steps: The invention provides an SNP molecular marker related to the ATP concentration of sperm of a breeding rabbit, wherein the SNP is positioned in the 6 th intron region of the NDUFV2 gene (reference sequence accession number: NC_ 091441.1) of the rabbit. The nucleotide sequence of the SNP molecular marker is shown as SEQ ID NO. 1. In this sequence, the 141 th base from the 5' end is a C/G polymorphic site (denoted by K) corresponding to the 1453 rd base of the reference sequence NC-091441.1. 5'-TGAAAGGCAGAGTTAAAGAGATTCCCAATAGCCCAATAGCCAGTTAGGCCAGGCTGAAGCCAGGAGCTTCATCCAGGTTTCCCATGTGGATGGTAGGGACCCAAGCACTTGGGCCATCTTCTGCTGCTTTCCCAGGGGCGKTAGCAGGGGAGCTGGATCAGAAGTGGAAGAGCCACAACTTGAACCGACACCCATATGGGATGTTGGTGTTACAGGTCACAGCTTAACCCACTGTGCCACAATACTGGTCCCCTTCAGTGCTTTTCTTTTGGCTCACATTTCTTACAAATTGGCTTATGG-3'(SEQ ID NO:1). K at 141 th base from 5' end in the nucleotide sequence of the SNP molecular marker is related to energy metabolism capability of sperm of the breeding rabbits, and the ATP concentration of sperm of the breeding rabbits with the locus genotype of homozygous GG and heterozygous CG is obviously higher than that of sperm of the individual breeding rabbits with the genotype of homozygous CC. The invention also provides a primer pair for detecting the SNP molecular marker, which comprises an upstream primer and a downstream primer, wherein the nucleotid