Search

CN-121975968-A - TaMADS1-D1 haplotype molecular marker and application thereof in regulation and control of quality and yield of wheat

CN121975968ACN 121975968 ACN121975968 ACN 121975968ACN-121975968-A

Abstract

The application discloses TaMADS-D1 gene haplotype molecular markers, which relate to the technical field of genetic engineering, wherein wheat TaMADS-D1 gene haplotypes comprise a Hap1 haplotype, a Hap2 haplotype and a Hap3 haplotype, wherein Hap1 is a high-quality low-yield haplotype, hap2 is a low-quality high-yield haplotype, hap3 is a high-quality high-yield haplotype, meanwhile, the application discloses molecular markers for distinguishing three haplotypes, C of the haplotype Hap2 and the haplotype Hap1 is changed into T at a position of-1691 bp of a promoter, and C of the haplotype Hap3 is changed into T and T is changed into C at a position of-1374 bp and-1257 bp of the promoter respectively. The application solves the problem that the existing breeding mode can not achieve both quality and yield, and has very broad application prospect in high-yield and high-quality genetic breeding of wheat.

Inventors

  • LI AILI
  • GENG SHUAIFENG
  • MAO LONG
  • LIU SHAOSHUAI
  • Deng Zhongyin
  • CHE YUQING
  • CHEN QIHANG

Assignees

  • 中国农业科学院作物科学研究所

Dates

Publication Date
20260505
Application Date
20250917

Claims (7)

  1. The TaMADS1-D1 gene haplotype molecular marker is characterized in that the wheat haplotype comprises a Hap1 haplotype, a Hap2 haplotype and a Hap3 haplotype, the haplotype molecular marker comprises three SNP molecular markers, The first SNP molecular marker is positioned at the-1691 bp position of the wheat TaMADS-D1 gene promoter region, and has C/T polymorphism; the second SNP molecular marker is positioned at the-1374 bp position of the wheat TaMADS-D1 gene promoter region, and C/T polymorphism exists; The third SNP molecular marker is positioned at the-1257 bp of the wheat TaMADS-D1 gene promoter region, and has C/T polymorphism.
  2. 2. Use of TaMADS a 1-D1 gene haplotype according to claim 1 for identifying wheat variety yield and quality traits.
  3. 3. A method for screening or assisting in screening wheat comprising the steps of: Detecting whether haplotypes of wheat to be detected based on TaMADS-D1 gene promoter are haplotypes Hap1, hap2 or Hap3; When the wheat variety to be detected comprises haplotype Hap1, the wheat variety is of high quality and low yield, and the nucleotide sequence of TaMADS-D1 gene promoter is shown as SEQ ID NO. 1; When the wheat variety to be detected comprises haplotype Hap2, the wheat variety is low-quality and high-yield, and the nucleotide sequence of TaMADS-D1 gene promoter is shown as SEQ ID NO. 2; when the wheat variety to be detected comprises haplotype Hap3, the wheat variety is of high quality and high yield, and the nucleotide sequence of TaMADS-D1 gene promoter is shown as SEQ ID NO. 3.
  4. 4. A method for increasing the yield and quality of wheat, characterized in that the wheat is a wheat material containing the novel synthetic wheat of high quality and high yield haplotype Hap3 as claimed in claim 1, comprising introducing high yield and high quality haplotype Hap3 into a conventional variety by constructing a near isogenic line.
  5. 5. The method for increasing yield and quality of wheat according to claim 4, wherein the wheat is a wheat variety of high quality low yield haplotype Hap1 or high yield high quality Hap2, and the method is to introduce and overexpress the high quality high yield haplotype Hap3 according to claim 1 into wheat by constructing a near isogenic line.
  6. 6. A primer for identifying a promoter haplotype of TaMADS-D1 genes, comprising: D1-2-F-1645:CCGTGTTCCTAGTCCATTGC D1-2-R-1645:AGCTGGCTATAACAGTTGCC。
  7. 7. the use of the primer according to claim 6 for screening or identifying the promoter activity of wheat TaMADS-D1 gene.

Description

TaMADS1-D1 haplotype molecular marker and application thereof in regulation and control of quality and yield of wheat Technical Field The invention relates to the technical field of genetic engineering, in particular to TaMADS-D1 gene haplotype molecular markers and application thereof in regulating and controlling quality and yield of wheat. Background About 20% of the world population is based on wheat, whose yield directly affects the dietary safety of 35 million people. However, with the improvement of human living standard, the quality requirements of people on wheat are also improved, and high-yield and high-quality breeding is the most urgent breeding task of contemporary breeders. There is often an antagonistic relationship between wheat yield and quality, i.e., increasing one index may sacrifice the other. For example, high-yielding wheat varieties typically have higher biomass and grain numbers, but may have lower protein content and gluten quality, whereas high-quality wheat, while exhibiting superior processing quality, tends to have less yield than high-yielding varieties. This phenomenon is mainly determined by the gene regulatory mechanism, and there may be some competing or inhibiting effect on the genetic basis of different traits. Nevertheless, breeders have attempted to break this bottleneck by molecular breeding techniques such as gene editing and whole genome selection, looking for key genes that can optimize both yield and quality. However, there are still few research cases for successfully achieving the synergistic improvement of the two, which is still one of the important problems to be solved in the field of wheat breeding. Disclosure of Invention The invention aims to solve the technical problem that the existing breeding mode cannot give consideration to the wheat yield and the wheat quality, and the two have antagonistic relationship, and aims to provide TaMADS-D1 gene haplotype molecular markers and application thereof in regulating and controlling the wheat quality and the wheat yield. The invention is realized by the following technical scheme: In a first aspect, taMADS-D1 gene haplotype molecular markers, said wheat haplotype comprising a Hap1 haplotype, a Hap2 haplotype and a Hap3 haplotype, said haplotype molecular markers comprising three SNP molecular markers, The first SNP molecular marker is positioned at the-1691 bp position of the wheat TaMADS-D1 gene promoter region, and has C/T polymorphism; the second SNP molecular marker is positioned at the-1374 bp position of the wheat TaMADS-D1 gene promoter region, and C/T polymorphism exists; The third SNP molecular marker is positioned at the-1257 bp of the wheat TaMADS-D1 gene promoter region, and has C/T polymorphism. In a second aspect, the use of TaMADS-D1 gene haplotypes for identifying wheat variety yield and quality traits. In a third aspect, a method for screening or assisting in screening wheat varieties comprises the steps of: detecting whether haplotypes of wheat to be detected are haplotypes Hap1, hap2 or Hap3 based on TaMADS-D1 gene promoters, wherein when the wheat variety to be detected comprises the haplotypes Hap1, the wheat variety is high-quality and low-yield, and the nucleotide sequence of the TaMADS-D1 gene promoter is shown as SEQ ID NO. 1; when the wheat variety to be detected comprises haplotype Hap2, the wheat variety is low-quality and high-yield, and the nucleotide sequence of TaMADS-D1 gene promoter is shown as SEQ ID NO. 2; when the wheat variety to be detected comprises haplotype Hap3, the wheat variety is of high quality and high yield, and the nucleotide sequence of TaMADS-D1 gene promoter is shown as SEQ ID NO. 3. In a fourth aspect, a method for increasing the yield and quality of wheat, characterized in that the wheat is a wheat material of the novel synthetic wheat of the high-quality high-yield haplotype Hap3, the method comprising introducing the high-yield high-quality haplotype Hap3 into a conventional variety by constructing a near isogenic line. As one of the preferable technical schemes, the wheat is a wheat variety of high-quality low-yield haplotype Hap1 or high-yield high-quality Hap2, and the method is to introduce the high-quality high-yield haplotype Hap3 of claim 1 into the wheat by constructing a near isogenic line. In a fifth aspect, a primer for identifying a haplotype of a TaMADS-D1 gene promoter, wherein the primer pair comprises: D1-2-F-1645:CCGTGTTCCTAGTCCATTGC D1-2-R-1645:AGCTGGCTATAACAGTTGCC。 In a sixth aspect, the use of the above primer for screening or identifying wheat TaMADS1-D1 gene promoter activity. Compared with the prior art, the invention has the following advantages and beneficial effects: 1. The invention discloses haplotype analysis of E-type MADS-box genes TaMADS-D1 for regulating flower development, which discovers 3 haplotypes. Wherein, hap1 is a high-quality low-yield haplotype, hap2 is a low-quality high-yield haplotype, and Hap3 is a high-quali