Search

CN-121975972-A - Internal reference gene of different tissues of industrial hemp under waterlogging stress and application thereof

CN121975972ACN 121975972 ACN121975972 ACN 121975972ACN-121975972-A

Abstract

The invention discloses reference genes of different tissues of industrial cannabis under waterlogging stress and application thereof, wherein the reference genes comprise ScActin genes, scTATA genes and ScTIP genes. The stable internal reference gene can be used as a reliable reference for functional gene expression analysis under waterlogging stress of industrial hemp, provides key technical support for subsequent research such as excavation of waterlogging-tolerant related functional genes, signal path analysis and the like, and promotes industrial hemp stress-resistant molecular breeding research.

Inventors

  • DU GUANGHUI
  • WANG SHANSHAN
  • Tang Kailei
  • OUYANG WENJING
  • CHEN XIANMIN
  • CHEN JIKANG

Assignees

  • 云南大学

Dates

Publication Date
20260505
Application Date
20260204

Claims (9)

  1. 1. Reference genes of different tissues of industrial hemp under waterlogging stress comprise ScActin genes, scTATA genes and ScTIP genes.
  2. 2. The reference gene of claim 1 as a reference for analysis of expression of functional genes under waterlogging stress of industrial hemp.
  3. 3. The use according to claim 2, wherein ScActin is used as a root reference gene.
  4. 4. The use according to claim 2, wherein ScTATA is used as a stem and leaf reference gene.
  5. 5. The use according to claim 2, wherein ScTIP41 is used as a reference gene for roots, stems, leaves.
  6. 6. The use according to claim 2, wherein said functional gene expression analysis is performed by real-time fluorescent quantitative qRT-PCR.
  7. 7. The use according to claim 6, wherein the real-time fluorescent quantitative qRT-PCR amplification primer of reference gene ScActin2 is: F:ATGAATGCCGATACGCTGTT; R:TTGAACCTGTCCTTGGAGC。
  8. 8. The use according to claim 6, wherein the real-time fluorescent quantitative qRT-PCR amplification primer of reference gene ScTATA is: F:CTGAAGTAAGGGTATCGTC; R:TTCTGTAATGTTGGGACTA。
  9. 9. The use according to claim 6, wherein the real-time fluorescent quantitative qRT-PCR amplification primer of reference gene ScTIP is: F:TCTGATTCTGCTGCTTACA; R:TAGAGGTTACCAGGGACTT。

Description

Internal reference gene of different tissues of industrial hemp under waterlogging stress and application thereof Technical Field The invention belongs to the field of plant molecular biology, and particularly relates to internal reference genes of different tissues of industrial cannabis under waterlogging stress and application thereof. Background Industrial hemp (Cannabis satival.) is used as a crop with both economic and ecological values, and its fiber can be used in textile and construction fields, and seeds can be processed into foods and oils. However, industrial hemp is easy to suffer from waterlogging stress in the growth cycle, damages the cell structure of root system, inhibits photosynthesis and disturbs the metabolism of substances, so that the growth of plants is blocked, the yield is reduced sharply and even the plants die, and the large-scale planting and industrial development of the plants are severely restricted. Gene expression analysis is a core means for analyzing a plant response adversity stress molecular mechanism, wherein the real-time fluorescent quantitative polymerase chain reaction (qRT-PCR) is widely used for detecting the expression level of a target gene due to the advantages of strong specificity, high sensitivity and good repeatability. However, the accuracy of qRT-PCR results is highly dependent on the stability of reference genes, i.e. the reference genes need to be constantly expressed under different experimental conditions (such as stress treatment), different tissues and organs and different varieties, so that the reference can be used as a reference for calibrating the expression quantity of target genes, and errors caused by the differences of RNA extraction efficiency, reverse transcription efficiency and PCR reaction systems can be counteracted. Currently, in plant stress-related studies, commonly used internal genes are mostly conventional housekeeping genes, such as genes encoding Actin (ACT), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), 18S ribosomal RNA (18S rRNA), and the like. Although the genes show a certain stability under partial plants or specific stress, the stability has obvious species specificity, tissue specificity and stress condition specificity, for example, the ACT gene stably expressed in arabidopsis drought stress has obvious expression fluctuation under rice waterlogging stress, the same gene is stably expressed in industrial hemp leaves, and the expression quantity in root systems can be changed drastically due to stress response. The molecular mechanism research aiming at the waterlogging stress of the industrial hemp is still in the starting stage, and no research system has been available for screening and verifying the reference genes which can be stably expressed in different tissues (such as roots, stems and leaves) of the industrial hemp under the waterlogging stress. The existing research mostly directly uses reference genes of other plants or selects industrial hemp housekeeping genes which are not verified by waterlogging stress, so that the accuracy of the target gene expression quantity detected by qRT-PCR is doubtful, and further, the screening, functional analysis and the promotion of molecular breeding work of key genes for the waterlogging response of the industrial hemp are interfered. Therefore, a scientific screening system is needed to be established, and the reference genes with high expression stability under the condition of waterlogging stress and in different tissues are screened from the industrial cannabis sativa candidate genes, so that reliable technical support is provided for accurately analyzing the waterlogging response molecular mechanism of the industrial cannabis sativa and cultivating waterlogging-tolerant industrial cannabis sativa varieties. Disclosure of Invention In order to solve the technical problems, the invention provides the following technical scheme: The invention relates to internal reference genes of different tissues of industrial cannabis under waterlogging stress, which comprise ScActin, scTATA and ScTIP41. The invention also relates to the reference gene as a reference for analysis of functional gene expression under waterlogging stress of industrial hemp. In a preferred embodiment of the invention, scActin2 is used as a root reference gene. In a preferred embodiment of the invention, scTATA is used as an internal gene for stems and leaves. In a preferred embodiment of the present invention, scTIP41 is used as an internal gene of root, stem and leaf. In a preferred embodiment of the invention, the functional gene expression analysis is performed by real-time fluorescent quantitative qRT-PCR. In a preferred embodiment of the invention, the real-time fluorescent quantitative qRT-PCR amplification primers for reference gene ScActin2 are: F:ATGAATGCCGATACGCTGTT; R:TTGAACCTGTCCTTGGAGC。 In a preferred embodiment of the invention, the real-time fluorescent quantitative qRT-PCR amplifica