CN-121975973-A - SSR core primer combination, kit and application for identifying high saikosaponin content in bupleurum varieties
Abstract
The invention belongs to the technical fields of identification of variety resources and germplasm innovation, and discloses an SSR core primer combination, a kit and application for identifying high saikosaponin content in bupleurum varieties. The invention utilizes microsatellite molecular marker development technology to screen and obtain a pair of specific SSR core primers (CHSSR F/CHSSR 1R). The primer combination can specifically amplify a characteristic band of 136 bp in the high saikosaponin bupleurum varieties, so that the characteristic band can be rapidly and accurately identified and distinguished from other low saikosaponin bupleurum varieties. The SSR core primer combination, the kit and the identification method provided by the invention overcome the defects of time consumption, high cost, dependence on equipment and the like of the traditional chromatographic identification method, have the advantages of reliable result, simple and convenient operation, high detection efficiency and the like, and are beneficial to popularization, protection and medicinal material quality control of the bupleurum varieties with high saikosaponin.
Inventors
- CHENG MENGRONG
- PENG XIAOGANG
- CHENG JIE
- LI WEI
- DING XIAOFEI
- WU YINBO
- YANG HAN
- CAO JIAN
- XIA SONG
Assignees
- 黄冈师范学院
Dates
- Publication Date
- 20260505
- Application Date
- 20260214
Claims (9)
- 1. An SSR core primer combination for identifying the content of high saikosaponin in bupleurum varieties, which is characterized by comprising a core primer pair with a nucleotide sequence of CHSSR to F, CHSSR to 1R and a target sequence of CHSSR to be specifically amplified; wherein the primer sequence of CHSSR F is TGCCCACCAAAGAAAATCAAA, and is shown as SEQ ID NO. 1; The primer sequence of CHSSR R is TGAGGAGGGGCCACAAAAT, and is shown as SEQ ID NO. 2; CHSSR1 has a core sequence :TGCCCACCAAAGAAAATCAAAGTAGCACTGAAATGCTAATAAGTGCTAACTTTATACAACTTGATATAATAATAATAAAGACACATACTTCCCGTACGAAGTGTCGGCATCCTAATGATTTTGTGGCCCCTCCTCA, as shown in SEQ ID NO. 3.
- 2. An SSR core primer combination according to claim 1, wherein the 5' end of the primer shown in nucleotide sequence CHSSR F and/or CHSSR R is labelled with a fluorescent reporter group.
- 3. An SSR core primer combination according to claim 2, wherein the fluorescent reporter group is FAM, HEX, TAMRA, sybr or ROX.
- 4. Use of an SSR core primer combination according to any one of claims 1-3 in the preparation of a product for identifying a variety with a high saikosaponin content in bupleurum.
- 5. The application of a product containing the SSR core primer combination according to any one of claims 1-3 in identifying the bupleurum variety high saikosaponin is characterized in that when the SSR core primers with nucleotide sequences CHSSR F and CHSSR R are amplified to obtain a characteristic band of 136bp, the bupleurum sample to be detected is high saikosaponin, and when other bands or no characteristic band is generated, the bupleurum sample to be detected is low in saikosaponin content.
- 6. A kit for identifying a bupleurum variety "high saikosaponin", characterized by comprising an SSR core primer combination according to any one of claims 1-3.
- 7. The kit of claim 6, further comprising HSTaq DNA polymerase, dNTPs, 10 Xbuffer, positive control reference, negative control reference, and ultrapure water.
- 8. A method for identifying high saikosaponin of bupleurum varieties is characterized in that the identification is carried out by utilizing the SSR core primer combination of any one of claims 1-3 or the kit of any one of claims 6-7, when a characteristic band of 136bp is amplified by SSR core primers with nucleotide sequences of CHSSR F and CHSSR R, the characteristic band indicates that a bupleurum sample to be detected is high saikosaponin, and when other bands are or are not present, the characteristic band indicates that the bupleurum sample to be detected is not high saikosaponin.
- 9. The method according to claim 8, comprising the steps of: S1, extracting genomic DNA of a bupleurum sample to be detected; S2, performing PCR amplification by using the genome DNA extracted in the step S1 as a template and using the SSR core primer combination of any one of claims 1-3; S3, parting the PCR amplification product obtained in the step S2, and judging the parting result in a strip mode.
Description
SSR core primer combination, kit and application for identifying high saikosaponin content in bupleurum varieties Technical Field The invention belongs to the technical fields of identification of variety resources and germplasm innovation, and particularly relates to an SSR core primer combination, a kit and application for identifying high saikosaponin of bupleurum variety. Preferably, the fluorescent reporter group is FAM, HEX, TAMRA, sybr or ROX. Background The saikosaponin is derived from bupleurum of Umbelliferae, is a traditional common traditional Chinese medicine, is a core active ingredient which plays roles of relieving exterior syndrome, reducing fever, soothing liver, relieving depression and the like, and has different saikosaponin contents in bupleurum of different varieties and producing areas, and the identification result provides quantitative and qualitative reference for the quality standard of specified bupleurum medicinal materials and related preparations, so that the stability and safety of clinical medication are ensured. At present, the bupleurum root with high saikosaponin content is detected according to liquid chromatography, the method has high equipment-dependent identification degree and overlong detection time, and has low economic cost and time cost for the grower, Therefore, in order to better manage and guide planting of the bupleurum varieties with high saikosaponin, establishing a set of rapid and effective bupleurum variety resource identification method becomes a technical problem which needs to be solved by the technicians in the field. The molecular marking technology has the characteristics of high polymorphism, short test period, no environmental influence and the like, and becomes the future development direction of variety identification and protection. Therefore, the SSR molecular marker has good application prospect in variety specificity evaluation and protection. Disclosure of Invention In order to overcome the defects and shortcomings in the prior art, the invention provides an SSR core primer combination, a kit and application for identifying the bupleurum variety high saikosaponin. In order to achieve the above object, the present invention is realized by the following technical scheme: In a first aspect, the invention provides an SSR core primer combination for identifying a variety with high saikosaponin content in bupleurum varieties, wherein the SSR core primer combination comprises a core primer pair with a nucleotide sequence of CHSSR to F, CHSSR to 1R, and a target sequence of specific amplification of the SSR core primer pair is CHSSR core sequence; CHSSR1F primer sequence TGCCCACCAAAGAAAATCAAA (SEQ ID NO: 1); CHSSR1R primer sequence TGAGGAGGGGCCACAAAAT (SEQ ID NO: 2); the core sequence :TGCCCACCAAAGAAAATCAAAGTAGCACTGAAATGCTAATAAGTGCTAACTTTATACAACTTGATATAATAATAATAAAGACACATACTTCCCGTACGAAGTGTCGGCATCCTAATGATTTTGTGGCCCCTCCTCA(SEQ ID NO: 3). of CHSSR1 wherein the SSR core primer refers to a primer designed based on the SSR core sequence. Preferably, the 5' end of the primer shown in the nucleotide sequence CHSSR F and/or CHSSR R is marked with a fluorescent reporter group. In a second aspect, the invention provides an application of the SSR core primer combination in preparing a product for identifying a variety with high saikosaponin content in bupleurum varieties. In a third aspect, the invention provides an application of a product comprising the SSR core primer combination in identifying a high saikosaponin variety in bupleurum varieties. When the nucleotide sequences are CHSSR F and CHSSR R, a characteristic band of 136bp is amplified according to the designed primer, the bupleurum sample to be detected is indicated to be high saikosaponin, and the presence of other bands or the absence of the characteristic band indicates that the bupleurum sample to be detected is low in saikosaponin content. In a fourth aspect, the invention provides a kit for identifying a high saikosaponin variety in bupleurum varieties, which comprises the SSR core primer combination. Preferably, the kit also comprises HSTaq DNA polymerase, dNTPs, 10 Xbuffer, positive control reference, negative control reference and ultrapure water. In a fifth aspect, the invention provides a method for identifying a high saikosaponin variety in bupleurum varieties, which uses the SSR core primer combination or the kit to identify, when a primer with nucleotide sequence of CHSSR F and CHSSR R and designed by SSR core sequence is amplified to obtain a 136bp characteristic band, the characteristic band indicates that a bupleurum sample to be detected is high saikosaponin, and other bands or no bands indicate that the bupleurum sample to be detected is not high saikosaponin. Preferably, the method for identifying the high saikosaponin variety in the bupleurum variety comprises the following steps: s1, extracting genomic DNA of a bupleurum sample to be detected; s2, taking the genome DNA extrac