Search

CN-121975976-A - Tea tree UGT708AC25 molecular marker and application of metabolite thereof in regulating plant internode length

CN121975976ACN 121975976 ACN121975976 ACN 121975976ACN-121975976-A

Abstract

The invention belongs to the technical field of biology, and particularly relates to application of a tea tree internode length related gene CsUGT708AC25 in reducing the length of poplar and tea tree internodes. The invention discloses application of a seedling stage molecular marker of a tea plant internode length related gene CsUGT708AC25, which is used for identifying whether the plant belongs to internode plants. The invention also provides the application of the CsUGT 706 AC25.1 gene and the CsUGT 706 AC25.2 gene in the negative regulation of the internode length of plants, and the silencing of the CsUGT 706 AC25.1 gene and the CsUGT 706 AC25.2 gene can inhibit the content of vitexin and isovitexin in tea trees.

Inventors

  • LIU HAORAN
  • YAO MINGZHE
  • CHEN LIANG
  • DUAN LINGXIAO
  • MA JIANQIANG
  • Fang Hanmo

Assignees

  • 中国农业科学院茶叶研究所

Dates

Publication Date
20260505
Application Date
20260408

Claims (8)

  1. 1. The application of the seedling stage molecular marker of the tea plant internode length related gene CsUGT708AC25 is characterized in that the application is used for identifying whether the tea plant belongs to an internode plant or not; The molecular markers are amplified by the following primer pairs: Marker0927: 5’-TTATTTTTCTAAAACAAAATGCCAC-3’ Marker1125:5’-CAAACTTCAAATTGGAAATTACAAA-3’。
  2. 2. the method for identifying whether the plant belongs to the internode plant by utilizing the molecular marker in the seedling stage is characterized by comprising the following steps: 1) Extracting RNA of a plant to be detected and reversely transcribing the RNA into cDNA, wherein the plant is tea tree or poplar; 2) Amplifying the CsUGT708AC25 coding region by using the molecular Marker primers Marker0927 and Marker1125 as set forth in claim 1; when the amplification result is CsUGT708AC25.1 genotype, judging that the plant to be detected is a short section inter-plant; when the amplification result is CsUGT708AC25.2 genotype, judging that the plant to be detected is a long internode plant; The nucleotide sequence of the CsUGT708AC25.1 gene is shown in SEQ ID NO. 1, and the nucleotide sequence of the CsUGT708AC25.2 gene is shown in SEQ ID NO. 2.
  3. The use of csugt 706 ac25.1 gene, csugt 706 ac25.2 gene, characterized by down regulating internode length of plants; The nucleotide sequence of the CsUGT708AC25.1 gene is shown in SEQ ID NO. 1, and the nucleotide sequence of the CsUGT708AC25.2 gene is shown in SEQ ID NO. 2; The plant is tea tree or poplar.
  4. 4. The use of the CsUGT 706 AC25.1 gene and the CsUGT 706 AC25.2 gene according to claim 3, wherein the CsUGT 706 AC25.1 gene and the CsUGT 706 AC25.2 gene reduce the internode length of poplar, and the inhibition effect of the CsUGT 706 AC25.1 is stronger than that of the CsUGT 706 AC25.2.
  5. The application of CsUGT 706 AC25.1 gene and CsUGT 706 AC25.2 gene is characterized in that CsUGT 706 AC25.1 gene and CsUGT 706 AC25.2 gene are silenced, and the content of vitexin and isovitexin in tea tree is inhibited.
  6. 6. Use of the csugt 706 ac25.1 gene, csugt 706 ac25.2 gene according to claim 5, characterized in that: the csugt 706 ac25.1 related primers are: CsUGT 706 AC25.1 antisense primer-1:5 ' CGGAGTCAGATGACCCATGC ' 3' CsUGT 706 AC25.1 antisense primer-2:5 ' GGGGCTTACGGGGAAGGATT ' 3' CsUGT 706 AC25.1 antisense primer-3:5 ' TGTGCACATAGTCATCGGAT ' 3' CsUGT 706 AC25.1 antisense primer-4:5 ' AGTTGTTCTCCTTTTTCGAG ' 3' CsUGT 706 AC25.1 antisense primer-5:5 ' TCTGAAATCACCCTCTGGTC ' 3' The csugt 706 ac25.2 related primers are: CsUGT 706 AC25.2 antisense primer-1:5 ' CCGGAGTCAGATGACCCATG ' 3' CsUGT 706 AC25.1 antisense primer-2:5 ' GGGGCTTACGGGGAAGGATT ' 3' CsUGT 706 AC25.1 antisense primer-3:5 ' GGTAACGGAGAGAACGTAAT ' 3' CsUGT 706 AC25.1 antisense primer-4:5 ' TGTGCACATAGTCATCGGAT ' 3' CsUGT 706 AC25.1 antisense primer-5:5 'GGTGGGAGGTTACTTAAGAC'.
  7. 7. A method for reducing the internode length of poplar and tea tree is characterized in that vitexin and isovitexin are externally sprayed or vitexin and isovitexin are added in an internode tissue culture formula, so that the internode length of plants is reduced.
  8. 8. A method for reducing internode length in poplar and tea trees as claimed in claim 7, wherein: The internode tissue culture 1 and the internode tissue culture 2 are used for tissue culturing poplar, so that the internode length of poplar can be reduced; the internode spray liquid 1 and the internode spray liquid 2 are sprayed on the tea trees, so that the internode length of the tea trees can be reduced.

Description

Tea tree UGT708AC25 molecular marker and application of metabolite thereof in regulating plant internode length Technical Field The invention belongs to the technical field of biology, and particularly relates to application of a tea tree internode length related gene CsUGT708AC25 in reducing the length of poplar and tea tree internodes, wherein the application comprises gene cloning, molecular marker assisted breeding in seedling stage and internode length growth regulator. Background The tea is labor-intensive industry, and the selection of tea varieties suitable for mechanical picking is beneficial to the large-scale and industrialization of the tea industry. Internode length is an important factor affecting mechanical picking, and regulating the internode length of tea trees is one of the important points of mechanical picking tea tree breeding. Internode length is a complex quantitative trait controlled by multiple genetic loci, which have been successfully mapped to a series of Quantitative Trait Loci (QTLs) that regulate internode length variation, as follows: 1. OsCYPq1: Zhao D D, Son J H, Farooq M, et al., 2021. Identification of candidate gene for internode length in rice to enhance resistance to lodging using QTL analysis[J/OL]. Plants, 10(7): 1369( QTL analysis was used to identify rice stem length candidate genes to enhance lodging resistance [ J/OL ]. Plants, 10 (7): 1369). 2. Cla015407: Gebremeskel H, Dou J, Li B, et al., 2019. Molecular mapping and candidate gene analysis for GA3 responsive short internode in watermelon (Citrullus lanatus)[J/OL]. International Journal of Molecular Sciences, 21(1): 290( Molecular localization of gibberellin GA 3 -responsive inter-pup gene in watermelon (Citrullus lanatus) and candidate gene analysis [ J/OL ]. Journal of International molecular science, 21 (1): 290). 3. EI: Sun X, Shu J, Ali Mohamed A M, et al., 2019. Identification and Characterization of EI (Elongated Internode) gene in tomato (Solanum lycopersicum)[J/OL]. International Journal of Molecular Sciences, 20(9): 2204( Identification and characterization of the Elongation Internode (EI) gene in tomato (Solanum lycopersicum) [ J/OL ]. Journal of International molecular science, 20 (9): 2204). 4. OsWRKY21: Wei X, Zhou H, Xie D, et al., 2021. Genome-wide association study in rice revealed a novel gene in determining plant height and stem development, by encoding a WRKY transcription factor[J/OL]. International Journal of Molecular Sciences, 22(15): 8192( Rice whole genome association studies revealed a new gene encoding the WRKY transcription factor determining plant height and stalk development [ J/OL ]. J.International molecular science, 22 (15): 8192). 5. TB1: Vann L, Kono T, Pyhäjärvi T, et al., 2015. Natural variation in teosinte at the domestication locus teosinte branched1 (tb1)[J/OL]. PeerJ, 3: e900( Natural mutation study of the acclimation site teosinte branched (tb 1) of the class hollyhock [ J/OL ]. PeerJ, 3:e900). Cloning internode length related genes, developing corresponding molecular markers, improving plant internode length through molecular breeding, and being beneficial to improvement of plant types, however, the molecular markers related to the tea plant internode length are fewer. The invention of CN118048390A, application of tea tree UGT708AC25 gene, informs of the application of tea tree UGT708AC25 gene in regulating plant height, but the internode length is not completely equal to the plant height, the plant height is determined by the internode length and the internode number, and regulating plant height can be realized by regulating stem internode development, branch number and internode number. And CN118048390a is not referred to in its entirety as "internode". Disclosure of Invention The invention aims to provide an application of a tea tree UGT708AC25 molecular marker and a metabolite thereof in regulating internode length. In order to solve the problems, the invention provides an application of a seedling stage molecular marker of a tea plant internode length related gene CsUGT708AC25, which is used for identifying whether the tea plant belongs to short internode plants or not; The molecular markers are amplified by the following primer pairs: Marker0927: 5’-TTATTTTTCTAAAACAAAATGCCAC-3’(SEQ ID NO:5) Marker1125:5’-CAAACTTCAAATTGGAAATTACAAA-3’ (SEQ ID NO:6)。 The invention also provides a method for identifying whether the plant belongs to a short internode plant by using the seedling stage molecular marker, which comprises the following steps: 1) Extracting RNA of a plant to be detected and reversely transcribing the RNA into cDNA, wherein the plant is tea tree or poplar; 2) Amplifying the CsUGT708AC25 coding region by using the molecular Marker primers Marker0927 and Marker 1125; when the amplification result (base sequence result) is CsUGT 706 AC25.1 genotype, judging (predicting) the plant to be detected as an internode plant; When the amplification result (base sequen