Search

CN-121987813-A - DNA tetrahedron medicine compound for treating retinal ischemia reperfusion injury

CN121987813ACN 121987813 ACN121987813 ACN 121987813ACN-121987813-A

Abstract

The application provides a DNA tetrahedron drug compound for treating retinal ischemia reperfusion injury, which belongs to the field of eye disease treatment and molecular biology, and YAP saRNA is connected to the tetrahedron drug compound. The tetrahedron drug complex can efficiently and safely deliver YAP sarNA, improve the expression level of YAP in cells, inhibit the oxidative stress of retina cells and iron death, thereby effectively treating RI/RI and providing a new choice for treating the tetrahedron drug complex.

Inventors

  • YAN MING
  • LIU JINGYING
  • LUO DELUN
  • LIU JINNAN
  • SONG YANPING
  • YE YA

Assignees

  • 中国人民解放军中部战区总医院

Dates

Publication Date
20260508
Application Date
20260409

Claims (9)

  1. 1. A DNA tetrahedral drug complex for treating retinal ischemia reperfusion injury, wherein YAP saRNA is attached to the tetrahedral drug complex, and wherein the YAP saRNA has nucleotide sequences GUUAGAUACUCUGAGUCAACU and UUGACUCAGAGUAUCUAACAA.
  2. 2. The DNA tetrahedral pharmaceutical composition according to claim 1, wherein the preparation method of the DNA tetrahedral pharmaceutical composition comprises adding S1-SARNA SENSE strand, the antisense strand of the SARNA, S2 strand, S3 strand and S4 strand into buffer solution respectively to prepare solution with equal concentration, mixing the 5 solutions uniformly, heating and cooling.
  3. 3. The DNA tetrahedral pharmaceutical composition of claim 2, wherein the S1-SARNA SENSE strand nucleotide sequence is ATTTATCACCCGCCATAGTAGACGTATCACCAGGCAGTTGAGACGAACATTCCTAAGTCTGAATTTTTGUUAGAUACUCUGAGUCAACUTT.
  4. 4. The DNA tetrahedral pharmaceutical composition of claim 3, wherein said S2 strand nucleotide sequence is ACATGCGAGGGTCCAATACCGACGATTACAGCTTGCTACACGATTCAGACTTAGGAATGTTCG, said S3 strand nucleotide sequence is ACTACTATGGCGGGTGATAAAACGTGTAGCAAGCTGTAATCGACGGGAAGAGCATGCCCATCC, said S4 strand nucleotide sequence is ACGGTATTGGACCCTCGCATGACTCAACTGCCTGGTGATACGAGGATGGGCATGCTCTTCCCG, and said saRNA antisense strand nucleotide sequence is UUGACUCAGAGUAUCUAACAA.
  5. 5. The DNA tetrahedral pharmaceutical composition according to claim 3, wherein the buffer comprises 50mM MgCl 2 , 10 mM Tris-HCl, pH 8.0, and/or wherein the preparation is heated to 95 ℃ for 10min and cooled to 4 ℃ for 20min.
  6. 6. Use of a DNA tetrahedral pharmaceutical complex according to any one of claims 1-5 for the preparation of a medicament for the treatment of retinal ischemia reperfusion injury.
  7. 7. The use according to claim 6, wherein the retinal ischemia reperfusion injury is that caused by trauma, surgery, ocular vascular obstruction or glaucoma.
  8. 8. The use according to claim 6, wherein the medicament is in the form of an injection, an eye drop or an eye ointment.
  9. 9. The use according to claim 6, wherein the medicament further comprises an anti-inflammatory agent and/or a neurotrophic factor.

Description

DNA tetrahedron medicine compound for treating retinal ischemia reperfusion injury Technical Field The application belongs to the field of eye disease treatment and molecular biology, and in particular provides a DNA tetrahedron pharmaceutical composition for treating retinal ischemia reperfusion injury. Background Retinal ischemia/reperfusion injury (RI/RI) is the primary pathological mechanism leading to vision impairment. At present, the treatment means of RI/RI are very limited clinically, and mainly comprise antioxidation treatment, such as using antioxidants of vitamin C, vitamin E and the like, but the effect of the medicines is limited and targeting is lacking. Anti-inflammatory treatments such as glucocorticoids, however, can cause serious side effects over time. Neuroprotective therapies, such as the use of neurotrophic factors, are inefficient in their delivery and difficult to achieve effective therapeutic concentrations. Oxidative stress and iron death play a key role in RI/RI, but the prior art is not effective in regulating these pathological processes. Yes-associated protein (YAP) is a core effector of the Hippo signaling pathway involved in cell survival, proliferation migration and tissue repair by regulating gene transcription. Studies have shown that YAP acts as a negative regulator of iron death, and activated YAP can promote ubiquitination degradation of ACSL4 to reduce iron death by transcription up-regulating NEDD4L in myocardial I/R injury. In addition, YAP induces expression of SLC7a11 and GPX4 through TEAD binding motif on its gene promoter, enhancing antioxidant defenses of cells, thereby inhibiting iron death. Thus, upregulation of YAP expression is considered a potential strategy for treating RI/RI. In addition, although YAP has therapeutic potential as a negative regulator of iron death, its expression level is insufficient in RI/RI, and existing delivery systems such as viral vectors, liposomes, etc. are mostly insufficient in stability, delivery effect, targeting, toxicity, etc., and efficient delivery systems for targeted delivery of YAP saRNA to retinal cells are lacking. The existing treatment method can not effectively solve the problems of oxidative stress and cell death in RI/RI, and development of a new treatment strategy is urgently needed, and development of an efficient, safe and targeted delivery system is a key for realizing YAP gene therapy on retinal ischemia/reperfusion injury. Disclosure of Invention The patent aims to provide a novel nano-composite (tFNAs-YAP saRNA), which can effectively treat RI/RI by efficiently delivering YAP saRNA, improving the expression level of YAP in cells and inhibiting oxidative stress of retina cells and iron death. In one aspect, the application provides a DNA tetrahedron drug complex for treating retinal ischemia reperfusion injury, the tetrahedron drug complex having YAP saRNA attached thereto. Further, the nucleotide sequences of YAP saRNA are GUUAGAUACUCUGAGUCAACU and UUGACUCAGAGUAUCUAACAA. Further, the preparation method of the pharmaceutical composition comprises the steps of respectively adding S1-SARNA SENSE strand, the saRNA antisense strand, the S2 strand, the S3 strand and the S4 strand with equal concentration into a buffer solution, uniformly mixing, heating and cooling. Further, the S1-SARNA SENSE chain nucleotide sequence is ATTTATCACCCGCCATAGTAGACGTATCACCAGGCAGTTGAGACGAACATTCCTAAGTCTGAATTTTTGUUAGAUACUCUGAGUCAACUTT. Further, the S2 strand nucleotide sequence is ACATGCGAGGGTCCAATACCGACGATTACAGCTTGCTACACGATTCAGACTTAGGAATGTTCG, the S3 strand nucleotide sequence is ACTACTATGGCGGGTGATAAAACGTGTAGCAAGCTGTAATCGACGGGAAGAGCATGCCCATCC, the S4 strand nucleotide sequence is ACGGTATTGGACCCTCGCATGACTCAACTGCCTGGTGATACGAGGATGGGCATGCTCTTCCCG, and the saRNA antisense strand nucleotide sequence is UUGACUCAGAGUAUCUAACAA. Further, the buffer is 10mM Tris-HCl buffer containing 50mM MgCl 2, pH 8.0. Further, the mixture was heated to 95℃for 10min and cooled to 4℃for 20min. In another aspect, the application provides the use of the DNA tetrahedron pharmaceutical composition described above in the preparation of a medicament for treating retinal ischemia reperfusion injury. Further, the retinal ischemia reperfusion injury is a retinal ischemia reperfusion injury caused by trauma, surgery, ocular vascular obstruction or glaucoma. Further, the medicine is in the form of injection, eye drop or eye ointment. Further, anti-inflammatory agents and/or neurotrophic factors are included in the medicament. The beneficial effects of the application at least comprise: (1) tFNAs is used as a vector, can efficiently deliver YAP saRNA to retina cells, and remarkably improves YAP expression level. (2) Multiple protection mechanisms, by inhibiting oxidative stress and iron death, comprehensively protect retinal cells. (3) TFNAs has good biocompatibility and low toxicity, and can realize accurate delivery. (4) The significant therapeutic effect is that tFNA