Search

CN-121991954-A - Application of miR-996 in regulation and control of yellow taxis of pea aphids

CN121991954ACN 121991954 ACN121991954 ACN 121991954ACN-121991954-A

Abstract

The invention belongs to the technical field of agricultural biology, and discloses application of miR-996 in adjustment and control of yellow taxis of pea aphids. The research of the invention proves that the api-miR-996 regulates and controls the sensitivity of the pea aphids to yellow stimulus through the targeting target gene ApROR, plays a role in negative regulation on the yellow stimulus of the pea aphids, the expression of the api-miR-996 up regulates and inhibits the sensitivity of the pea aphids to yellow stimulus, so that the yellow stimulus proportion is reduced, and the expression of the api-miR-996 is inhibited to enhance the yellow stimulus of the pea aphids. The invention provides a new target for regulating and controlling the yellow-axis chemotaxis of the pea aphids, provides a new insight for a molecular mechanism of the yellow-axis chemotaxis behavior of the pea aphids, and provides a theoretical basis for developing a new aphid control pesticide based on the yellow-axis chemotaxis of the pea aphids.

Inventors

  • SHANG FENG

Assignees

  • 西南大学

Dates

Publication Date
20260508
Application Date
20260116

Claims (9)

  1. The application of the api-miR-996 in regulating and controlling the yellow taxis of the pea aphids is characterized in that the nucleotide sequence of the api-miR-996 is UGACUAGAGUUACACUCGUCAUGACGAGUGUAACUCUAGUCA.
  2. 2. Use of api-miR-996 as claimed in claim 1 for combating pea aphids or for producing a medicament for combating pea aphids.
  3. 3. The application of the compound according to claim 1 or 2, wherein the api-miR-996 plays a role in negative regulation on the yellow taxis of the pea aphids, the expression of the api-miR-996 is up-regulated to inhibit the sensitivity of the pea aphids to yellow stimulus, so that the yellow taxis proportion is reduced, and the expression of the api-miR-996 is inhibited to enhance the yellow taxis of the pea aphids.
  4. 4. The use according to claim 3, wherein the api-miR-996 regulates the sensitivity of the Pisum sativum aphid to yellow stimulus by targeting the target gene ApROR, the api-miR-996 regulates ApROR in an negative regulation manner, the increased expression of the api-miR-996 leads to the decreased expression of ApROR, and the decreased expression of the api-miR-996 promotes the up-regulation of ApROR.
  5. The application of the ApROR gene in regulating and controlling the yellow taxis of the pea aphids is characterized in that the yellow taxiing proportion of the pea aphids is reduced when the ApROR gene expression level in the pea aphids is reduced, and the yellow taxiing proportion of the pea aphids is increased when the ApROR gene expression level in the pea aphids is up-regulated.
  6. 6. A method for regulating and controlling the yellow taxis of pea aphids is characterized in that the expression of api-miR-996 in the pea aphids is promoted or inhibited, and the gene ApROR is targeted for negative regulation so as to regulate and control the yellow taxis of the pea aphids.
  7. 7. The method of claim 6, wherein the method of regulating is that api-miR-996 plays a role in negative regulation on yellow taxis of pea aphids, and upregulation of api-miR-996 expression leads to reduction of ApROR expression, inhibition of sensitivity of pea aphids to yellow stimulation leads to reduction of yellow taxiing proportion, inhibition of api-miR-996 expression promotes upregulation of ApROR expression, and pea aphid yellow taxis is enhanced.
  8. 8. The method of claim 6, wherein the substance that promotes the expression of api-miR-996 in the body of Aphis pisiformis is apo-miR-996 mimic:UGACUAGAGUUACACUCGUCAUGACGAGUGUAACUCUAGUCA.
  9. 9. The method according to claim 6, wherein the substance inhibiting the expression of api-miR-996 in the body of Aphis pisiformis is as follows: UGACUAGAGUUACACUCGUCA as api-miR-996 inhibitor.

Description

Application of miR-996 in regulation and control of yellow taxis of pea aphids Technical Field The invention belongs to the technical field of agricultural biology, and particularly relates to application of miR-996 in adjustment and control of yellow taxis of pea aphids. Background Phototactic (Phototaxis) is a behavioral response of insects to external light stimuli and is one of the important manifestations of insect interaction with the environment. The phototactic behavior of insects is usually manifested as a directional movement of light of a specific wavelength or intensity, which plays a key role in the physiological and ecological processes of foraging, reproduction, habitat selection, etc. of insects. Phototactic includes not only responses to light intensity, but also specific responses to light wavelength, which are specific manifestations of phototactic. "chemotaxis" is generally used to outline the trending behavior of insects on a particular color, and includes "true vision" and "wavelength specific behavior. Aphids are a worldwide distribution of pests with a broad host range and variety. As aphids can parthenogenesis, the breeding speed is extremely high, a large-scale population can be formed in a short time, and serious threat is caused to agricultural production. In addition, the unreasonable use of chemical pesticides, which leads to increasingly outstanding pesticide resistance, re-rampant and residue problems, makes aphid control using conventional chemical control methods a serious challenge. Therefore, the search for more environment-friendly and sustainable aphid prevention and control technology becomes an important research direction of current agricultural pest management. Yellow board aphid attraction is started in 60 th century of 20 and some areas of China. The yellow board aphid attracting technology has the advantages of high use safety, low cost, simple operation and remarkable attracting and killing effect. As a physical control method, yellow board aphid attraction can replace chemical pesticides to a certain extent, and the pesticide usage amount is reduced, so that the environmental pollution and the pesticide residue risk are reduced. Especially in closed environments such as greenhouse, etc., the application effect of the yellow plate aphid attracting technology is more outstanding. At present, yellow plate aphid attracting technology is widely applied to some agricultural high and new technology demonstration bases, orchards, tea gardens, vegetable fields and animal lands, and becomes an important pest control means in green agriculture and organic agriculture. In recent years, application studies on the trapping and killing of aphids by yellow panels have been gradually increased, and the main focus has been on optimizing the use method of yellow panels to improve trapping and killing efficiency. For example, the best orientation, angle and number of yellow panels hanging in the field are studied to maximize the aphid attracting effect. In addition, researches on the yellow plate chromaticity optimization are conducted by researchers aiming at different aphid types. For example, myzus persicae was attracted by adjusting the chromaticity of yellow plates, which were found to have a stronger attraction for Myzus persicae. In addition, studies on wheat aphids also show that yellow colour plates have a remarkable effect in trapping and killing wheat aphids. Aphid yellow-hiking is a typical representation in insect phototaxis, and the analysis of behavioral mechanisms and ecological functions has dual value for revealing host-location strategies for agricultural pests. Through multidimensional studies such as standardized color card selection experiments, spectral response determination, wild trapping verification and the like, it is generally confirmed that most aphid types show remarkable yellow trends in yellow (580-595 nm), green (520-560 nm) and red (620-750 nm) three-color systems, the spectral selection characteristics of the aphid can be deeply related to host plant recognition mechanisms thereof, the study indicates that the aphid adopts a visual treatment strategy of 'color opposition', photoreceptors of the aphid generate excitatory signals on yellow-green light wave bands, and the aphid shows inhibitory responses on blue light (about 440 nm) and ultraviolet light (340-380 nm), and the neural signal coding mode can optimize the capability of the aphid to rapidly recognize healthy plants in complex habitats. However, although the biological significance of aphid yellowing has been widely focused, the molecular mechanism behind it is still unclear. microRNA (miRNA) is a kind of small molecular non-coding RNA widely involved in various physiological processes of insects, and is the front and focus of research in the field of current insect gene transcription regulation. In insect physiological regulation network research, miRNAs have been demonstrated to be inv