Search

CN-121991958-A - OsABA8ox1 gene promoter mutant and application thereof in improving plant alkali stress resistance

CN121991958ACN 121991958 ACN121991958 ACN 121991958ACN-121991958-A

Abstract

The invention provides a OsABA ox1 gene promoter mutant and application thereof in improving alkali stress resistance of plants, and belongs to the technical field of plant breeding. The invention screens and obtains OsABA OX1 gene promoter region closely related to the endogenous ABA content of rice, carries out fixed point editing on the promoter region through CRISPR/Cas9 technology, obtains a mutant capable of reducing OsABA OX1 gene expression level, can improve the endogenous ABA content of rice based on the mutation mode, can remarkably improve the alkali stress resistance of rice (compared with wild type, the survival rate of pOSABA OX1-PE6 material after 12 days recovery is up to 66.67%), can be used for improving rice germplasm resources, and has important application value in the breeding field of stress-resistant rice varieties.

Inventors

  • Shi An Changjie
  • XIE XIANZHI
  • SUN YAO

Assignees

  • 山东省农业科学院

Dates

Publication Date
20260508
Application Date
20260407

Claims (10)

  1. 1. A OsABA ox1 gene promoter mutant is characterized in that compared with a wild rice OsABA ox1 gene promoter, the mutant has 9bp deletion of 144bp to 135bp upstream of a start codon, is mutated into G at 145bp base T and has base T deletion at 157bp, and the expression level of OsABA ox1 genes can be specifically reduced.
  2. 2. The mutant according to claim 1, wherein the nucleotide sequence is as shown in SEQ ID NO. 27.
  3. 3. The mutant of claim 1, wherein the wild-type rice OsABA ox1 gene promoter comprises any one of the following nucleotide sequences: i) A nucleotide sequence shown as SEQ ID NO. 1; ii) a nucleotide sequence having the same promoter function obtained by inserting, deleting or substituting one or more nucleotides in the nucleotide sequence as shown in i).
  4. 4. An sgRNA comprising any one of the following nucleotide sequences: i) The nucleotide sequence is GGTGGCAGCTATTTATAGAT; ii) a nucleotide sequence having the same targeting function obtained by inserting, deleting or replacing one or more nucleotides in the nucleotide sequence as shown in i).
  5. 5. A biological material comprising the mutant of any one of claims 1-3 or the sgRNA of claim 4, wherein the biological material is an expression cassette, a vector, a transgenic cell or a recombinant viral particle.
  6. 6. Use of a mutant according to any one of claims 1 to 3, or of an editing reagent for OsABA ox1 gene promoter for reducing the expression level of OsABA ox1 gene, or for preparing a kit for reducing the expression level of OsABA ox1 gene, for editing OsABA ox1 gene promoter to mutate it to a mutant according to any one of claims 1 to 3.
  7. 7. Use of a mutant according to any one of claims 1 to 3, or of an editing agent for OSABA OX1 gene promoter, in any one of: i) Increasing the endogenous abscisic acid content of the plant, or preparing a kit for increasing the endogenous ABA content of the plant; ii) increasing the alkali stress resistance of the plant, or preparing a kit for increasing the alkali stress resistance of the plant; iii) Cultivating transgenic plants with high endogenous ABA content and high alkali stress resistance; iv) directed improvement of plant varieties associated with alkali stress resistance; v) innovation and improvement of alkali-resistant plant germplasm resources; The editing agent is used for editing OsABA ox1 gene promoter to mutate into the mutant as claimed in any one of claims 1 to 3.
  8. 8. The use according to claim 7, wherein the plant is a oryza plant.
  9. 9. A method for reducing OsABA ox1 gene expression level, which comprises mutating the promoter of OsABA ox1 gene to obtain the mutant according to any one of claims 1-3.
  10. 10. A method for preparing transgenic oryza plants, or increasing the endogenous ABA content of oryza plants, or increasing the alkali stress resistance of oryza plants, comprising mutating the promoter of OsABA ox1 gene in said oryza plants to obtain the mutant according to any of claims 1-3.

Description

OsABA8ox1 gene promoter mutant and application thereof in improving plant alkali stress resistance Technical Field The invention relates to the technical field of plant breeding, in particular to a OsABA ox1 gene promoter mutant and application thereof in improving alkali stress resistance of plants. Background In recent years, the problem of global soil salinization is continuously aggravated, and the salinized land area tends to rise year by year. Development and utilization of severe saline-alkali soil for rice production and further improvement of rice yield in medium and mild saline-alkali soil have become important tasks for comprehensive treatment of saline-alkali soil and improvement of grain productivity. By utilizing molecular marker assisted breeding and other technologies, the saline-alkali tolerant key genes or functional sites are introduced into the main cultivar to directionally improve the alkali stress capability, so that the method is an efficient technical approach for solving the problems. However, the current practical gene resources for directional improvement of regional rice variety alkali resistance are still very deficient, and the production requirement for cultivation of new variety of saline-alkali tolerant rice is difficult to meet. Abscisic acid (ABA) is an important plant hormone for plants to cope with abiotic stress such as salt and alkali, drought and the like, and plays a key regulation role in the soda and alkali stress resistant process of rice. Under the condition of saline-alkali stress, especially soda-alkali stress, ABA can activate an antioxidant system to remove active oxygen accumulation by inducing air hole closure and reducing water loss, and simultaneously regulate and control ion transporter expression and maintain intracellular Na +/K+ ion balance, so that the tolerance of plants to high-salt high-pH adversity is enhanced, and the survival rate and the growth vigor of rice under the saline-alkali environment are obviously improved. OsABA8ox1 gene codes for rice ABA8' -hydroxylase and is a key negative regulation factor for regulating endogenous ABA level. The gene reduces the content of ABA in plants mainly through oxidative degradation of catalytic activity ABA, and further participates in regulation and control of ABA-dependent stress signal paths. Under the saline-alkali stress, the expression of OsABA ox1 can be obviously induced to be up-regulated, the higher the stress intensity is, the higher the expression quantity is, the high expression of the gene can accelerate the decomposition of ABA, so that the deficiency of the accumulation of endogenous ABA of plants is caused, the ABA-mediated stress-resistant signal path is further weakened, the problems of aggravation of plasma membrane damage, accumulation of a large amount of active oxygen, unbalanced Na +/K+ balance and the like of rice are caused, and the alkali resistance is obviously reduced. Therefore, the expression level of OsABA ox1 directly influences the endogenous ABA steady state of rice, and is an important regulation node for determining soda and alkali resistance of rice. A plurality of researches show that the site-directed mutagenesis on the coding region of the important gene often brings a plurality of negative phenotypes, the coding region is not changed, the problems of abnormal protein structure, functional inactivation, unexpected translation regulation disorder and the like caused by mutation of the coding region can be effectively avoided by editing the fine regulation gene expression quantity on the promoter, and the accurate, gentle up-regulation or down-regulation of the gene expression level is realized on the basis of keeping the natural coding function of the gene and normal protein expression, so that the non-targeted negative effect and genetic background interference caused by gene editing are greatly reduced. Meanwhile, the regulation mode can rely on the cis-acting element characteristic of the promoter to realize the space-time specific expression regulation of genes, so that the change of the gene expression quantity is accurately matched with the requirements of crop growth and development and stress response, and a safer, efficient and accurate molecular breeding technical path is provided for the directional improvement of agronomic characters such as stress resistance, high quality and the like of crops, and is also a preferred strategy for realizing the fine regulation of gene functions in the current plant molecular breeding. The prior researches prove that the endogenous ABA content can be improved by RNAi inhibition OsABA ox1 expression, so that the salt and alkali resistance of the rice is enhanced, but the related researches are focused on the functional inhibition of the gene coding region, the influence of the functional mutation of the promoter region on the expression regulation and the alkali resistance of the rice is not found, the functional site