CN-121991963-A - Transcription control factor OsSEUSS gene and application thereof in resisting southern rice black-streaked dwarf virus
Abstract
The invention relates to a method for targeted editing of a rice LIM binding domain-containing transcription regulatory factor OsSEUSS gene by using CRISPR/Cas9 technology and application of the gene in crop breeding of southern rice black-streaked dwarf virus.
Inventors
- SUN ZONGTAO
- LI LULU
- ZHOU CHANGMEI
- Xu Yugu
- ZHANG HEHONG
- LI YANJUN
- CHEN JIANPING
Assignees
- 宁波大学
Dates
- Publication Date
- 20260508
- Application Date
- 20241108
Claims (9)
- 1. The application of the rice transcription regulating factor OsSEUSS gene in the breeding of rice black-streaked dwarf virus resistant food crops in south China, wherein the gene sequence is shown as SEQ ID NO. 1.
- 2. The use as claimed in claim 1, wherein the OsSEUSS gene has the amino acid sequence shown in SEQ ID NO. 2.
- 3. The use according to any one of claims 1-2, wherein the crop is preferably rice, maize, wheat, oat and barley, more preferably rice, most preferably flower 11.
- 4. The use of any one of claims 1-3 to increase rice resistance to southern rice black-streaked dwarf virus (SRBSDV) by negatively regulating OsSEUSS gene expression.
- 5. The use of claim 4, wherein the negative regulation OsSEUSS gene expression is achieved by a CRISPR/Cas9 system, the target of which is shown in SEQ ID No. 3.
- 6. A method for improving resistance of rice to southern rice black-streaked dwarf virus uses CRISPR/Cas9 technology to target and edit a rice transcription regulatory factor OsSEUSS gene containing LIM binding domain, wherein the nucleotide sequence of the OsSEUSS gene is shown as SEQ ID NO. 1.
- 7. An sgRNA whose target sequence binding region is shown in SEQ ID NO. 3.
- 8. A method for identifying resistance of rice to southern rice black-streaked dwarf virus comprising the steps of: Taking young leaves of the rice T0 generation and T1 generation to be detected, taking wild medium flower 11 as a reference, extracting DNA by a CTAB method, amplifying by a target specific primer, detecting an amplified product by 1% gel electrophoresis, recovering fragments with specific strips and correct sizes by gel, sequencing, and determining mutation conditions of the rice OsSEUSS gene to be detected by comparing sequences of the amplified products.
- 9. The method of claim 8, wherein the target-specific primers are as follows: SEQ ID NO:6 OsSEUSS-F:ACAGTTCTTATCCAGTAAGATATTTG SEQ ID NO:7 OsSEUSS-R:GAGGGTTCTGTTGACCCTGCAGATG。
Description
Transcription control factor OsSEUSS gene and application thereof in resisting southern rice black-streaked dwarf virus Technical Field The invention relates to the technical field of transgenosis and the field of plant disease control, in particular to a method for targeted editing of a rice LIM binding domain-containing transcription regulatory factor OsSEUSS gene by using a CRISPR/Cas9 technology and application of the gene in resisting southern rice black-streaked dwarf disease. Background The rice virus disease is a systematic infection disease with serious harm on rice crops in China, and has strong burst nature, serious disaster and large occurrence area, and is a serious difficulty in pest control. Southern rice black-streaked dwarf is a malignant viral disease of rice caused by the disease of southern rice black-streaked dwarf virus (Southern rice black-STREAKED DWARF virus, SRBSDV). The virus is a new virus species which is first identified and named by China and endangers crops, is first discovered by the agricultural university Zhou Guohui in south China in Yangxi county of Guangdong in the first time, and is formally identified as a new species of southern rice black-streaked dwarf virus in 2008. And then spreading to a plurality of main paddy rice producing areas such as Guangxi, hunan, hubei, hainan, jiangxi, zhejiang, fujian and Anhui and the like continuously, thereby causing great threat to paddy rice production in China, and being listed into a crop disease and insect pest directory by agricultural rural departments. The SRBSDV has very wide host range in the field, and can infect other gramineous plants or weeds, such as corn, wheat, sorghum, crabgrass, myrtle, barnyard grass, green bristlegrass and the like, besides being harmful to rice crops. Under the natural state, SRBSDV is transmitted by a mediator insect sogatella furcifera, typical symptoms after infection of hosts are expressed as short plants, increased tillering, short, broad and stiff leaves, dark green leaves, wax white tumor-shaped protrusions along the backs and stem bases of the leaf veins, and the plants cannot or are not completely spiked after the infection, and grain yield reduction and even harvest are often caused when the plant is serious. In recent years, in order to effectively prevent and control the occurrence of rice virus diseases, a plurality of domestic and foreign scholars have made good progress around the direction of resistance gene excavation, however, for such various rice viruses, the rice germplasm (including conventional rice, hybrid rice, sterile line, restorer line and the like) which is planted and popularized in a large area in China still lacks broad-spectrum resistance. Therefore, the system screens key host factors interacted with the rice viruses, excavates key genes or paths with broad-spectrum high resistance or high sense of the rice, prevents the key genes or paths from being clamped by the viruses in a directional modification mode, can enhance the broad-spectrum antiviral capacity of the rice, and provides important theoretical basis and technical support for comprehensive prevention and control of rice virus diseases and crop improvement. SEUSS was originally a transcription factor cloned from Arabidopsis in 2002, and the encoded protein contains at least two glutamine-rich fragments (Glutamine-rich domain, Q-rich) and a highly conserved heteromultimerized LIM binding domain (LDB). The LIM domain is a kind of regulating factor widely existing in eukaryote and has important effect on cell development process, and the LIM domain directly participates in various physiological and biochemical processes including gene transcription, cytoskeletal organization and signal transduction, and has important effect on regulating organ development, morphogenesis and the like of plants. For example, in monocotyledonous rice and dicotyledonous Arabidopsis, deletion SEUSS of a key gene can lead to stunted plant growth, partial loss of flower organ types, shortened main roots, and reduced lateral root numbers. In addition, researchers find that SEUSS in arabidopsis thaliana can be used as an important component protein of light-temperature signals to control the morphological formation of plants in a complex manner, so that the accurate control on the growth and development is realized, and the plants can be better adapted to the light-temperature environment. In addition to regulating the growth and development of plants, SEUSS transcription factors can also be involved in regulating the stress response of plants. Prior studies have found that SEUSS can induce liquid-liquid phase separation of plant cells through its N-terminal inherent disorder region (INTRINSICALLY DISORDERED REGION, IDR) to form biomacromolecule aggregates to promote expression of osmotic stress genes when arabidopsis senses osmotic stress, thereby enhancing stress tolerance of plants to osmotic stress. Although the research on S