Search

CN-121991964-A - Application of rice WRKY protein OsWRKY102 in resisting rice virus diseases

CN121991964ACN 121991964 ACN121991964 ACN 121991964ACN-121991964-A

Abstract

The invention relates to an application of a CRISPR/Cas9 technology to targeted editing of a rice OsWRKY102 gene in resisting rice virus diseases.

Inventors

  • SUN ZONGTAO
  • LI SHANSHAN
  • ZHANG HEHONG
  • LI LULU
  • CHEN JIANPING

Assignees

  • 宁波大学

Dates

Publication Date
20260508
Application Date
20241108

Claims (8)

  1. 1. The application of the OsWRKY102 gene in rice virus-resistant crop breeding is shown in SEQ ID NO. 1.
  2. 2. The use as claimed in claim 1, wherein the protein sequence of the OsWRKY102 gene is shown as SEQ ID NO. 2.
  3. 3. The use of any one of claims 1-2, wherein the rice virus is selected from the group consisting of rice stripe virus (RICE STRIPE virus, RSV), southern rice black streaked dwarf virus (Southern rice black-STREAKED DWARF virus, SRBSDV), and rice stripe mosaic virus (RICE STRIPE mosaic virus RSMV).
  4. 4. Use according to any one of claims 1 to 3, preferably rice, maize, wheat, oat and barley, more preferably rice, most preferably japan.
  5. 5. A method for improving rice resistance to rice viruses comprises the step of utilizing a CRISPR/Cas9 technology to target and edit a rice OsWRKY102 gene, wherein the nucleotide sequence of the OsWRKY102 gene is shown as SEQ ID NO.1, and the rice viruses are selected from the group consisting of rice stripe viruses (RICE STRIPE viruses, RSV), southern rice black streaked dwarf viruses (Southern rice black-STREAKED DWARF viruses, SRBSDV) and rice stripe mosaic viruses (RICE STRIPE mosaic virus RSMV).
  6. 6. A preparation method of rice virus resistance transgenic rice comprises the following steps of carrying out gene editing on starting rice to obtain transgenic rice, wherein the gene editing is realized through a Crispr/Cas9 system, and a target of the Crispr/Cas9 system is shown as SEQ ID NO. 3.
  7. 7. The method of claim 6, wherein the rice virus is selected from the group consisting of rice stripe virus (RICE STRIPE virus, RSV), southern rice black streaked dwarf virus (Southern rice black-STREAKED DWARF virus, SRBSDV) and rice stripe mosaic virus (RICE STRIPE mosaic virus RSMV).
  8. 8. An sgRNA whose target sequence binding region is shown in SEQ ID NO. 3.

Description

Application of rice WRKY protein OsWRKY102 in resisting rice virus diseases Technical Field The invention relates to the technical field of transgenosis and the field of plant disease control, in particular to a rice OsWRKY102 gene targeted editing by using a CRISPR/Cas9 technology and application thereof in resisting rice virus diseases. Background Rice stripe virus (RICE STRIPE virus, RSV), also known as rice stripe virus, belongs to the genus Celloviridae (Tenuivirus), is a multi-split negative sense single stranded RNA virus and is transmitted by the plant hopper (Laodelphax striatellus) as an insect medium. Under natural conditions, rice Stripe Virus (RSV) infects only grasses, but under laboratory conditions, rice stripe virus can infect nicotiana benthamiana by mechanical inoculation. Rice infected with rice stripe virus usually shows yellowing and necrosis on newly developed leaves, followed by plant retardation, heading malformation and few consequences, and in severe cases death. In general, rice Stripe Virus (RSV) is an arbour gracilis virus transmitted by the vector insect laodelphax striatellus in a persistent, proliferative manner, resulting in serious yield loss in southeast asia rice. This virus is the major viral disease that jeopardizes rice production. Southern rice black-streaked dwarf virus (Southern rice black-STREAKED DWARF virus, SRBSDV) belongs to a member of the fijivirus genus of the reoviridae family, and is transmissible by the mediator sogatella furcifera, which is not transmitted by eggs but is transmissible permanently. After the plant host is infected, the plant can be caused to grow in a malformation, and the main symptoms are that the plant is dwarfed, tillering is increased, the leaf color is dark green, white tumor-shaped protrusions appear on the leaf backs and stems, and the like. The virus mainly damages rice to cause black streaked dwarf disease in the south of Yangtze river of China, and damages corn to cause maize rough dwarf disease in the north of Yangtze river of China. Rice mosaic virus (RICE STRIPE mosaic virus RSMV) is a new species of rice virus reported in 2017 of the plant virus institute of agricultural university of south China, and is a cytoplasmic rhabdovirus which is found to infect rice for the first time. In recent years, the virus rapidly spreads in the south China rice area, and the harm is aggravated year by year, but the infection mechanism of the virus on host rice is not clear. Based on the defects in the prior art, the inventor of the invention uses a CRISPR/Cas9 gene editing system to carry out targeted editing on OsWRKY102, constructs a knock-out vector of YL-Hu-OsWRKY102, and transforms callus formed by induction of mature embryo of NiP of rice through a rice callus transfection technology. And (3) after the T0 generation transgenic rice seeds are obtained, continuing to propagate to obtain the T1 generation seeds, extracting the DNA of young leaves of the T1 generation single plant, amplifying sgRNA targeting sites by using target specific primers, and sequencing to obtain the homozygous mutant transgenic plants with stable inheritance. Experimental results show that the expression level of the OsWRKY102 mutant transgenic plant inoculated with RSV, including symptoms of the pathogenic plant and viruses on RNA level is obviously lower than that of the pathogenic wild control NIP plant. Therefore, the transgenic rice of the OsWRKY102 mutant can obviously enhance the resistance of the rice to RSV infection, and similar experiments show that the OsWRKY102 mutant also has a certain resistance to RSMV and SRBSDV infection, and the OsWRKY102 mutant plant has good application value in the transgenic field. The invention has practical guiding significance for cultivating transgenic plants with rice stripe disease resistance and related diseases, and has important application prospect in the field of plant disease control. Disclosure of Invention The invention relates to a rice OsWRKY102 gene and application thereof in resisting rice stripe disease, rice black streak dwarf and rice stripe mosaic. In one aspect, the rice OsWRKY102 gene has a nucleotide sequence shown in SEQ ID NO. 1 or has at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% sequence identity with SEQ ID NO. 1 or consists of the same. On the other hand, the OsWRKY102 gene has the amino acid sequence of the coded protein shown in SEQ ID NO. 2 or has at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% and 99% sequence identity with the amino acid coded by SEQ ID NO. 2 or consists of the amino acid. In some embodiments, the nucleotide sequence of the OsWRKY102 gene (SEQ ID NO: 1) is as follows: ATGTTCCCATCACCAGGGAGGGCGGTGATGGCGCTAGGCCACCACGGCGCCGCCCGCCAACCGCCGACCACCATGGCGGCGGCGGCCTCCTCGTCGACGACCTCCGCCGCCGCCGCCCCGGCCACGGCCACCACCACCGTCGCCTTCTCCTTCCAGCATCCCACGCCCACGCCGTCTCACCACCACCACCACCATGGCGTCCTAGGTTACAGCCCCCTCGTCCTCGACCACCACCACCCAACCACCGCCGCCGCCTCCTCGCACGCGCCCTCTCCTCCCACCCTCCACCACCACCACGGC