Search

CN-121991967-A - Application of Sichuan 7 haplotype grain shape gene in regulating and controlling grain size of plant

CN121991967ACN 121991967 ACN121991967 ACN 121991967ACN-121991967-A

Abstract

The invention relates to the technical field of plant breeding, in particular to application of Sichuan 7 haplotype grain shape genes in regulating and controlling grain size of plants. The gene comprises one or more of MADS1, GS3, GL3.3, GW5, FZP or qGW. The application comprises (1) positive regulation of GW5 haplotype in Sichuan 7, negative regulation of MADS1 haplotype, GS3 haplotype, GL3.3 haplotype and FZP haplotype, and (2) negative regulation of GS3 haplotype, GW5 haplotype and qGW haplotype in Sichuan 7. The Sichuan 7 gene haplotype and the combination thereof which can regulate and control the grain shape character of the plant are researched and obtained, and the invention has important application value in the field of plant breeding related to the grain shape character.

Inventors

  • XING YONGZHONG
  • ZHANG BO
  • LIU WENBO

Assignees

  • 崖州湾国家实验室
  • 华中农业大学

Dates

Publication Date
20260508
Application Date
20251218

Claims (10)

  1. 1. The application of Sichuan 7 gene haplotype or biological material containing the Sichuan 7 gene haplotype in regulating grain type or spike shape of plant is characterized in that the gene comprises one or more of MADS1, GS3, GL3.3, GW5, FZP or qGW.
  2. 2. The use according to claim 1, wherein the MADS1 haplotype in Chuan 7 comprises the nucleotide sequence as set forth in SEQ ID NO.1 and/or, The GS3 haplotype in Chuan 7 comprises the nucleotide sequence shown as SEQ ID NO.2 and/or, GL3.3 haplotypes in Chuan 7 include the nucleotide sequence as shown in SEQ ID NO.3 and/or, The GW5 haplotype in Chuan 7 comprises a nucleotide sequence shown as SEQ ID NO.4 and/or, FZP haplotype in Chuan 7 comprises the nucleotide sequence as shown in SEQ ID NO.5 and/or, The qGW haplotype in Chuan 7 includes the nucleotide sequence shown as SEQ ID NO. 6.
  3. 3. The use according to claim 1 or 2, characterized in that the use comprises any one of the following: (1) For grain length, GW5 haplotypes in Chuan 7 are positively regulated, MADS1 haplotypes, GS3 haplotypes, GL3.3 haplotypes and FZP haplotypes are negatively regulated; (2) For grain width, GS3 haplotype, GW5 haplotype and qGW haplotype in Chuan 7 are negative regulation; (3) For grain weight, MADS1 haplotype, GS3 haplotype, GL3.3 haplotype, GW5 haplotype, FZP haplotype or qGW haplotype in Chuan 7 are negative regulation.
  4. 4. A use according to claim 3, characterized in that the use comprises any one of the following: (1) Reducing grain size of a plant by reducing the expression level of the C7 haplotype GW5 in the plant or increasing the expression level of any one or more of the C7 haplotype MADS1, GS3, GL3.3, or FZP in the plant; (2) Increasing grain size of a plant by increasing the expression level of the C7 haplotype GW5 in the plant or decreasing the expression level of any one or more of the C7 haplotype MADS1, GS3, GL3.3, or FZP in the plant; (3) Decreasing the grain width of a plant by increasing the expression level of the C7 haplotype GS3, GW5 or qGW in the plant; (4) Increasing the grain width of a plant by decreasing the expression level of the C7 haplotype GS3, GW5 or qGW in the plant; (5) Reducing the grain weight of a plant by increasing the expression level of the C7 haplotype MADS1, GS3, GL3.3, GW5, FZP, or qGW in the plant; (6) The grain weight of the plant is increased by decreasing the expression level of the C7 haplotype MADS1, GS3, GL3.3, GW5, FZP, or qGW in the plant.
  5. 5. The use according to claim 4, wherein the level of expression of the gene is reduced by any one or more of gene editing, transcriptional level gene silencing or post-transcriptional gene silencing, and/or, The expression level of the gene is increased by any one of the following means: (1) Increasing the copy number of the gene; (2) Replacing a promoter of the gene; (3) Adding an enhancer upstream or downstream of the gene; (4) Optimizing the nucleotide sequence of the gene according to the type of host; (5) Modifying the gene, adding a stable tag or a coding gene of a signal peptide; Preferably, gene editing includes knocking out genes using CRISPR/Cas9, TALEN or ZFN systems, and/or, The transcriptional level gene silencing includes inhibiting gene expression using CRISPR interference or DNA methylation mediated silencing, and/or, The post-transcriptional gene silencing includes reducing gene expression using RNA interference or antisense RNA.
  6. 6. Use of a Sichuan 7 gene haplotype or biological material as described in any one of claims 1-5 in any one of the following: (1) Cultivating a transgenic plant; (2) Plant variety improvement associated with grain type or grain weight; (3) And (5) improving the germplasm resources of plants.
  7. 7. The use according to claim 6, wherein said use comprises cross breeding plants having said Sichuan 7 gene haplotype with other plants.
  8. 8. The use according to claim 7, wherein said cross-breeding comprises polymerizing one or more of said Sichuan 7 gene haplotypes in said other plant.
  9. 9. The use according to any one of claims 1 to 8, wherein the biological material is an expression cassette, a vector, a transgenic cell, a recombinant viral particle, a plant tissue or a plant organ.
  10. 10. The use according to any one of claims 1 to 9, wherein the plant is a monocot or dicot; Preferably, the plant is a oryza plant; further preferably, the plant is rice.

Description

Application of Sichuan 7 haplotype grain shape gene in regulating and controlling grain size of plant Technical Field The invention relates to the technical field of plant breeding, in particular to application of Sichuan 7 haplotype grain shape genes in regulating and controlling grain size of plants. Background The grain shape is an important factor for determining thousand grain weight of rice, and has higher genetic power. In the prior art, cloning and functional analysis of rice grain shape related genes have been greatly progressed, molecular mechanisms of a large number of grain shape genes are deeply analyzed, and a complex molecular regulation network is established, wherein the genes mainly relate to a G protein signal transduction regulation pathway, a Mitogen Activated Protein Kinase (MAPK) cascade signal regulation pathway, an ubiquitin proteasome pathway, a plant hormone signal pathway, a transcription factor regulation pathway and the like. At present, a great deal of reports on improving the appearance quality and yield of rice by using a single grain-shaped gene exist, for example, the excellent haplotype (such as a 4 th exon frame shift mutation) of a grain width gene GW2 can be used for remarkably increasing the yield of a single plant of the rice, the multi-copy variation genotype of GL7 can be used for enabling rice grains to be more slender and lower in chalkiness rate, and the variable splicing variation genotype of OsMADS1 can be used for enabling the rice grains to be longer, so that the yield and the quality can be synergistically improved. It has been shown that by genetic manipulation of a few grain genes, a large grain variation can be generated, which can provide a reference for the targeted change of rice grain size. For example, by knock-out or over-expression of various combinations of the G protein signaling genes GS3, DEP1, GGC2 and RGA1, a series of rice grain length-continuously mutated families can be created. Related studies have shown that only a few grain length genes (e.g., GL1, GS2, GS3, and GL 7) and grain width genes (e.g., GW5, GW5.1, GW7, and GW 8) can account for the vast majority of the grain-type variations in the rice core germplasm population, and that most of these genes belong to different grain-type regulatory pathways, suggesting that manipulation of grain-type genes from different regulatory pathways can likewise produce significant phenotypic variations. In addition, the gene editing system is utilized to knock out a plurality of genes simultaneously (synchronously knocking out GW2, GW5 and TGW 6), compared with a wild type, the grain length, grain width and thousand grain weight of the polygenic homozygous mutant are obviously increased, and meanwhile, the genes such as Gn1a, GW2, GL3.3 and Chalk5 are knocked out, so that the grain length, grain width and single plant yield of rice are obviously increased. Recent studies have also shown that small grain sterile lines can be created by editing individual grain genes. For example, research reports that the grain-shaped gene GSE3 regulates the grain size of rice through physical interaction with GS2, the GSE3 mutation in a sterile line can lead the grain to be small and the grain thickness to be obviously reduced, and the grain-shaped gene GSE3 is matched with a large grain restorer line to realize mixed sowing mechanical seed production. In addition, studies have been made on the realization of mechanical seed production by knocking out TGW5/D1 in a sterile line to significantly shorten the seed grains, then matching with a long grain restorer line, and sorting by utilizing the difference in seed length between the two. Disclosure of Invention In order to solve the problems in the prior art, the invention provides application of Sichuan 7 haplotype grain shape genes in regulating and controlling the grain size of plants. In a first aspect, the invention provides the use of a Sichuan 7 gene haplotype, or biological material comprising the same, for modulating the granular traits of a plant, characterised in that the gene comprises one or more of MADS1, GS3, GL3.3, GW5, FZP or qGW. Further, MADS1 haplotype in Chuan 7 includes the nucleotide sequence shown as SEQ ID NO.1 and/or, The GS3 haplotype in Chuan 7 comprises the nucleotide sequence shown as SEQ ID NO.2 and/or, GL3.3 haplotypes in Chuan 7 include the nucleotide sequence as shown in SEQ ID NO.3 and/or, The GW5 haplotype in Chuan 7 comprises a nucleotide sequence shown as SEQ ID NO.4 and/or, FZP haplotype in Chuan 7 comprises the nucleotide sequence as shown in SEQ ID NO.5 and/or, The qGW haplotype in Chuan 7 includes the nucleotide sequence shown as SEQ ID NO. 6. Nucleotide sequence as shown in SEQ ID NO. 1: ATGGGGAGGGGGAAGGTGGAGCTGAAGCGGATCGAGAACAAGATCAGCCGGCAGGTGACGTTCGCCAAGCGCAGGAACGGCCTGCTCAAGAAGGCCTACGAGCTCTCCCTCCTCTGCGACGCCGAGGTCGCCCTCATCATCTTCTCCGGCCGCGGCCGCCTCTTCGAGTTCTCCAGCTCATCATGCATGTACAAAACCTTGGAGAGGTACCGCAGCTGCAACTACAACTCACAGGATGCAGCA