CN-121991977-A - Application of rice E3 ubiquitin ligase OsCOP1 in rice antiviral
Abstract
The invention relates to application of RING type rice E3 ubiquitin ligase OsCOP1 in prevention and control of rice virus diseases, belonging to the fields of plant genetic engineering technology and disease control.
Inventors
- SUN ZONGTAO
- DU JUAN
- ZHOU CHANGMEI
- LI LULU
- ZHANG HEHONG
- LI YANJUN
- CHEN JIANPING
Assignees
- 宁波大学
Dates
- Publication Date
- 20260508
- Application Date
- 20241108
Claims (9)
- 1. An application of rice E3 ubiquitin ligase OsCOP1 in rice breeding of Rice Stripe Virus (RSV) and/or southern rice black-streaked dwarf virus (SRBSDV) is provided, wherein the nucleotide sequence of the rice E3 ubiquitin ligase OsCOP1 is shown as SEQ ID NO.1, and the amino acid sequence is shown as SEQ ID NO. 10.
- 2. The use according to claim 1, wherein the rice is japan.
- 3. A method for improving resistance of rice to rice stripe virus and/or southern rice black-streaked dwarf virus comprises transferring rice E3 ubiquitin ligase OsCOP1 into rice, wherein the nucleotide sequence of OsLOX gene is shown as SEQ ID NO. 1.
- 4.A method for detecting rice stripe virus and southern rice black-streaked dwarf virus resistant rice, comprising the steps of: Extracting total RNA of rice to be detected, reversely transcribing the total RNA into cDNA, taking OsUBQ gene of the rice as an internal reference, wherein a quantitative primer is shown as follows, and a transgenic strain with the relative expression quantity being obviously higher than that of a control over-expressed OsCOP1 gene is the resistant plant; qRT-OsCOP1-F GTGCGCCTGTCCATGTTTTT; qRT-OsCOP1-R TCATTCGTTTCACTCCCGCA; OsUBQ5-F ACCACTTCGACCGCCACTACT; OsUBQ5-R ACGCCTAAGCCTGCTGGTT。
- 5. A preparation method of rice stripe virus and southern rice black-streaked dwarf virus resistant rice comprises the following steps: (1) Cloning rice OsCOP1 genes; (2) Constructing an over-expression vector; (3) Agrobacterium transformation and callus induction culture; (4) Positive identification of transgenic plants.
- 6. The method of claim 5, wherein the cloning step of the rice OsCOP gene further comprises: primers OsCOP-F and OsCOP1-R were designed according to the Open Reading Frame (ORF) of OsCOP1, the primer sequences were as follows: OsCOP1-F ATGGGTGACTCGACGGTGGCCGGCG; OsCOP1-R TCAAGGAGCAAGTACAAGAACTTTA; The total volume of the PCR amplification system was 40. Mu.L, which comprised 2X PCR Buffer for KOD FX. Mu.L, 1. Mu.L each of the upstream and downstream primers (10. Mu.M), 4. Mu.L of dNTP Mix (2.5 mM), 1. Mu.L of cDNA template, 0.8. Mu.L of KOD FX, and 12.2. Mu.L of ddH 2O; the PCR amplification procedure comprises pre-denaturation at 94 ℃ for 3min, denaturation at 94 ℃ for 30s, annealing at 58 ℃ for 30s, extension at 72 ℃ for 2min for 35 cycles, final extension at 72 ℃ for 10min, recovery of PCR products, connection of pMD18-T vector, selection of monoclonal, colony PCR and sequencing to obtain correct pMD18-T-OsCOP1 recombinant plasmid with a length of 2058bp and encoding 685 amino acid sequences.
- 7. The method of any one of claims 5-6, the step of constructing the over-expression vector further comprising: the primer for connecting the enzyme cutting site is designed and used for constructing OsCOP gene binary expression vector PCV1300, and the primer sequence is as follows: PCV-OsCOP1-F CgACgACAAgACCgTCACCatgGGTGACTCGACGGTGGCCGG;PCV-OsCOP1-R gAggAgAagAgCCgTCgAGGAGCAAGTACAAGAACTTTAATG; The total volume of the PCR amplification system was 40. Mu.L, which comprised 2X PCR Buffer for KOD FX. Mu.L, 1. Mu.L each of the upstream and downstream primers (10. Mu.M), 4. Mu.L of dNTP Mix (2.5 mM), 1. Mu.L of cDNA template, 0.8. Mu.L of KOD FX, and 12.2. Mu.L of ddH 2 O; PCR amplification procedure, 94℃pre-denaturation for 3min, 94℃denaturation for 30s,58℃annealing for 30s,72℃extension for 2min,35 cycles, 72℃final extension for 10min; recovering the PCR product, and adding the end A of the PCR product after recovering; Adding an A-terminal system with total volume of 50 μl, including 38.5 μl of recovered PCR product, 1.5 μl of T4 DNA polymerase, and 2.1 μl of 10 XNEB Buffer, and adding an A-terminal reaction program with reaction time of 37 ℃ for 20min and 75 ℃ for 20min; The method comprises the steps of connecting the recovered product with the end A with the PCV1300 carrier with the end T, wherein the total volume of the connecting system is 10 mu L, the connecting system comprises 6 mu L of the recovered product with the end A and 4 mu L of the PCV1300 carrier with the end T, and the connecting reaction procedure is 75 ℃ for 20s and 37 ℃ for 30min; After connection, 10 mu L of the connection product is converted into DH5 alpha, after the connection product is kept stand on ice for 30min, a 42 ℃ water bath kettle is subjected to heat shock for 45s, the heat shock is rapidly inserted into ice after finishing, 500 mu L of non-resistant LB liquid medium is added into a super clean workbench, the super clean workbench is placed into a 37 ℃ shaking table, after 1h of culture at 200rpm, the mixture is centrifuged at 5000rpm for 1min, part of supernatant is discarded, the rest precipitate is uniformly smeared on a kanamycin resistance-containing LB plate, the mixture is placed into a 37 ℃ incubator for overnight culture, monoclonal is selected, and sequencing is performed after colony PCR (polymerase chain reaction) is performed, so that the correct PCV1300-OsCOP1 recombinant plasmid is obtained.
- 8. The method of any one of claims 5-7, the agrobacterium transformation and callus induction culture step further comprising: the agrobacterium transformation and callus induction culture comprises transforming the plasmid of PCV-OsCOP1 into GV3101 agrobacterium strain, adding 2 μl of PCV-OsCOP1 plasmid into 50 μl competence, mixing, transferring into a pre-chilled electric shock cup with a pipetting gun, performing electric shock transformation with 2200V voltage, adding 500 μl of non-resistant LB liquid medium, culturing at 28deg.C with 200rpm shaking table for 3h, centrifuging at 5000rpm for 1min, discarding part of supernatant, uniformly coating the rest precipitate on LB plate containing 50 μg/ml Kan and 50 μg/ml Rif, culturing for 3d in 28 deg.C incubator upside down, dehulling mature rice seeds, soaking in 75% alcohol for 5min, washing ddH 2 O for several times, soaking in 30% sodium hypochlorite solution for 30min, sterilizing, soaking ddH 2 O for 30min, culturing in 28 deg.C light incubator for 3 weeks with sterile forceps, culturing at 28 deg.C in a light incubator, culturing at 28 deg.C for 1 deg.C; The method comprises the steps of selecting a single clone of a transformed GV3101 strain from toothpick into an LB liquid culture medium, culturing OD 600 = 0.6, immersing the induced callus in an agrobacterium suspension culture solution for 5min, taking out the callus, placing the callus in a co-culture medium, culturing in a 26 ℃ illumination incubator for 2.5d, placing the callus on a hygromycin-containing culture medium for growing for 30-45d, transferring the callus after screening into a rooting culture medium, culturing in the illumination incubator to generate a green plant with roots, and culturing for 2 weeks to obtain the transgenic plant.
- 9. The method of any one of claims 5-8, the step of positively identifying the transgenic plant further comprising: Extracting total RNA of positive transgenic plants, reversely transcribing the total RNA into cDNA, taking OsUBQ genes of rice as internal references, and quantitatively introducing the primers as shown below, wherein the result shows that the relative expression quantity of the transgenic lines over-expressing OsCOP1 genes is obviously higher than that of the control, and qRT-OsCOP1-F GTGCGCCTGTCCATGTTTTT; qRT-OsCOP1-R TCATTCGTTTCACTCCCGCA; OsUBQ5-F ACCACTTCGACCGCCACTACT; OsUBQ5-R ACGCCTAAGCCTGCTGGTT。
Description
Application of rice E3 ubiquitin ligase OsCOP1 in rice antiviral Technical Field The invention relates to application of RING type rice E3 ubiquitin ligase OsCOP1 in prevention and control of rice virus diseases, belonging to the fields of plant genetic engineering technology and disease control. Background Rice is one of the important grain crops in China, and is subjected to a plurality of biotic and abiotic stresses in the rice production process, so that the occurrence of rice virus diseases is serious. Presently, there are up to 15 viral diseases found and identified on Rice, among which Rice stripe virus (RICE STRIPE virus, RSV, multiple negative sense strand RNA virus), rice black-streaked dwarf virus (Rice black-STREAKED DWARF virus, RBSDV, double-stranded RNA virus), southern Rice black-streaked dwarf virus (Southern Rice black-STREAKED DWARF virus, SRBSDV, double-stranded RNA virus) and Rice stripe mosaic virus (RICE STRIPE mosaic virus, RSMV, single negative sense strand RNA virus) are the most serious risks for food production in China. The rice stripe virus belongs to a member of the genus ciliated virus (Tenuivirus) and is transmitted in a persistent manner by the mediator insect Laodelphax striatellus. The early onset symptoms of infection are yellow leaves, yellow spots appear on the veins and surrounding, and when severe, the leaves curl and wither. As the RSV transmission mediator, namely, the Laodelphax striatellus (Laodelphax striatellus, SBPH), is transmitted through eggs, the transmission capacity is strong, the prevention and control difficulty is high, so that the rice stripe disease caused by RSV becomes one of important virus diseases which endanger southern rice areas in China. The rice stripe disease occurs in a plurality of provincial rice areas in China, and has serious influence on the grain safety production in China. The southern rice black-streaked dwarf virus belongs to a member of fijivirus (Fijivirus), is transmitted by a mediator insect sogatella furcifera, has high transmission speed, and can cause large-area outbreaks and epidemic in a short time. The symptoms of southern rice black-streaked dwarf virus infection are mainly represented by plant dwarfing, dark green leaves, neoplastic projections on the leaves and the like. The rice virus diseases mainly occur in the regions of the Yangtze river and the south of China, and cause serious harm to the safe production of rice. During long-term interactions between plants and viruses, plants evolved a variety of strategies to defend against viral infections, and ubiquitin-proteinase system (UPS) is one such regulatory mechanism. For UPS-mediated proteolysis, the protein substrate is first labeled with ubiquitin (this process is called ubiquitination) and then recognized and degraded by the 26S proteasome. Ubiquitination is a continuous reaction mediated by three enzymes, namely ubiquitin activating enzyme (E1), ubiquitin coupling enzyme (E2) and ubiquitin ligase (E3). The substrate specificity of ubiquitin-conjugating systems is determined by the E3 ligase, and currently, the well-defined E3 ubiquitin ligases are mainly HECT type, RING type and RBR type. There is growing evidence that E3 ubiquitin ligases play an important role in plant and virus interactions. For example, microtubule-associated RING-type E3 ligase (MEL) can ubiquitinate and promote the degradation of SHMT1, thereby initiating a series of plant immune signals that confer broad-spectrum resistance to pathogens on plants. OsCOP1 is a RING type E3 ubiquitin ligase, whether it is involved in rice antiviral infection is unclear and there is no evidence of literature. Disclosure of Invention The invention relates to an E3 ubiquitin ligase OsCOP gene in rice and application thereof: in one aspect, the application relates to OsCOP gene, the nucleotide sequence of which is shown as SEQ ID NO. 1. The method comprises the following steps: ATGGGTGACTCGACGGTGGCCGGCGCGCTGGTGCCATCGGTGCCGAAGCAGGAGCAGGCGCCGTCGGGGGACGCGTCCACGGCGGCGTTGGCGGTGGCGGGGGAGGGGGAGGAGGATGCGGGGGCGCGCGCCTCCGCGGGGGGCAACGGGGAGGCCGCGGCCGACAGGGACCTCCTCTGCCCGATCTGCATGGCGGTCATCAAGGACGCCTTCCTCACCGCCTGCGGCCACAGCTTCTGCTACATGTGCATCGTCACGCATCTCAGCCACAAGAGCGACTGCCCCTGCTGCGGCAACTACCTCACCAAGGCGCAGCTCTACCCCAACTTCCTCCTCGACAAGGTCTTGAAGAAAATGTCAGCTCGCCAAATTGCGAAGACAGCATCACCGATAGACCAATTTCGATATGCACTGCAACAGGGAAACGATATGGCGGTTAAAGAACTAGATAGTCTTATGACTTTGATCGCGGAGAAGAAGCGGCATATGGAACAGCAAGAGTCAGAAACAAATATGCAAATATTGCTGGTCTTCTTGCATTGCCTCAGAAAGCAAAAGTTGGAAGAGCTGAATGAGATTCAAACTGACCTACAGTACATCAAAGAAGATATAAGTGCTGTGGAGAGACATAGGTTAGAATTATATCGAACAAAAGAAAGGTACTCAATGAAGCTCCGCATGCTTTTGGATGAACCTGCTGCATCAAAGATGTGGCCCTCACCTATGGATAAACCTAGTGGTCTCTTTCCTCCCAACTCTCGGGGACCACTTAGTACATCAAATCCAGGGGGTTTACAGAATAAGAAGCTTGACTTGAAAGGTCAAATTAGTCATCAAGGATTTCAAAGGAGAGATGTTCTCACTTGCTCGGATCCTCCTAGTGCCCCTATTCAATCAGGCAACGTTATTGCTCGGAAGAGGCGAGTTCAAGCTCAGTTTAACGAGCTTCAAGAATACTATCTTCAAAGACGGCGTACCGGAGCACAATCACGTAGGCTGGAGGAAAGAGACATAGTAACAATAAATAAAGAAGGTTATCATGCAGGACT