CN-121991999-A - Gene GOT1 for improving utilization efficiency of corn nitrogen fertilizer
Abstract
The invention belongs to the technical field of agricultural biology, and relates to application of glutamic-oxaloacetic transaminase 1, namely GOT1 or an expression gene thereof in improving nitrogen fertilizer utilization efficiency and/or plant biomass of plants. The corn glutamic-oxaloacetic transaminase 1 gene Zm00001d043382 can effectively improve the utilization efficiency of corn nitrogen fertilizer, can improve the biomass of corn plants, and can be used for cultivating new varieties of high-efficiency corn.
Inventors
- WU YONGRUI
- ZHU YIDONG
- WANG HAIHAI
- HUANG YONGCAI
- CUI YAHUI
- WANG QIONG
Assignees
- 中国科学院分子植物科学卓越创新中心
Dates
- Publication Date
- 20260508
- Application Date
- 20241104
Claims (10)
- 1. The application of the glutamic-oxaloacetic transaminase 1, namely GOT1 or the expression gene thereof in improving the nitrogen fertilizer utilization efficiency of plants and/or the biomass of plants.
- 2. Use according to claim 1, wherein the plant is a gramineous crop selected from the group consisting of maize, rice, wheat, soybean, barley, oat, rye and sorghum, preferably maize.
- 3. The use according to claim 1, wherein said glutamic-oxaloacetic transaminase 1 is a maize-derived protein ZmGOT (NCBI accession Zm00001d 043382) having the amino acid sequence shown in SEQ ID No. 1 or a conservatively variant polypeptide thereof, said conservatively variant polypeptide having more than 90% homology to ZmGOT1 and having the function of glutamic-oxaloacetic transaminase 1.
- 4. The use according to claim 3, wherein the nucleotide sequence of the CDS sequence, which is the coding region of the expressed gene ZmGOT1 of the protein ZmGOT1, is SEQ ID NO. 2 or a nucleotide sequence having more than 90% homology with SEQ ID NO. 2.
- 5. Use according to claim 1, wherein the plant nitrogen fertilizer utilization efficiency and/or plant biomass is increased by over-expressing the protein GOT1 or a gene encoding it.
- 6. Use according to claim 5, wherein said over-expressed protein GOT1 or a gene encoding it, such as ZmGOT1, is achieved by: A. cloning a coding gene of a protein GOT1, such as ZmGOT1, such as a gene ZmGOT having a nucleotide sequence of SEQ ID NO:2, on a plasmid vector suitable for expression in Agrobacterium to form a recombinant plasmid, i.e., GOT1 overexpression vector, transforming the plant by Agrobacterium-mediated transformation to obtain a transgenic plant overexpressing the protein GOT1, or B. The gene ZmGOT encoding the protein GOT1, such as ZmGOT, for example, the gene ZmGOT having the nucleotide sequence of SEQ ID NO. 2 is cloned on a plant chromosome by a gene editing technology to obtain a transgenic plant over-expressing the protein GOT 1.
- 7. The use according to claim 6 for creating nitrogen-efficient transgenic plant varieties such as nitrogen-efficient maize new varieties.
- 8. The use as claimed in claim 7, wherein the plant is maize and the ubi promoter is used to regulate the expression of a gene encoding protein ZmGOT, such as gene ZmGOT having the nucleotide sequence of SEQ ID No. 2.
- 9. A method of identifying transgenic corn over-expressing protein ZmGOT1 as set forth in claim 8, comprising the steps of: extracting corn genome DNA, performing PCR amplification reaction by using the following primer pair, The forward primer GOT1OE-F TTAGCCCTGCCTTCATACGC (SEQ ID NO: 3), The reverse primer GOT1OE-R ATGGTGGGGAACGATTCGAG (SEQ ID NO: 4), When the PCR product size is 334bp and the amplified sequence is SEQ ID NO. 5, it is indicated that the corn genome comprises gene ZmGOT1 with the nucleotide sequence of SEQ ID NO.2 and/or Determining whether the protein expressed by the corn cells contains polypeptide with an amino acid sequence shown as SEQ ID NO. 1, When the detection result shows that the corn genome contains a gene ZmGOT with a nucleotide sequence of SEQ ID NO. 2 or the protein expressed by corn cells contains a polypeptide with an amino acid sequence of SEQ ID NO. 1, the transgenic corn is prompted to overexpress protein ZmGOT, and the corn variety is used as a candidate of the nitrogen high-efficiency variety.
- 10. A kit for performing the method of claim 9, comprising the following PCR primers for amplifying gene ZmGOT1 (NCBI accession number Zm00001d 043382): The forward primer GOT1OE-F TTAGCCCTGCCTTCATACGC (SEQ ID NO: 3), The reverse primer GOT1OE-R ATGGTGGGGAACGATTCGAG (SEQ ID NO: 4).
Description
Gene GOT1 for improving utilization efficiency of corn nitrogen fertilizer Technical Field The invention belongs to the technical field of agricultural biology, and particularly relates to application of a glutamic-oxaloacetic transaminase 1 (GOT 1) gene in improving nitrogen fertilizer utilization efficiency of plants and improving plant biomass. Background The plant needs to absorb major elements and trace elements for growth and development. Nitrogen is the mineral element with the greatest demand for plants and is also a key factor limiting plant growth. Nitrogen is an important component of plant protein synthesis, and the average nitrogen content in the protein can reach 16-18%. Meanwhile, the plant cell is also a component element of genetic material nucleic acid, biocatalyst enzyme, chlorophyll and cytoskeletal phosphatide, and plays an important role in plant life activities. Most plants absorb and utilize nitrogen elements through root systems, and yield is improved through nitrogen fertilizer application in agricultural production for a long time (Zhang, 2007). When the plant lacks nitrogen, the protein synthesis capability of the plant is reduced, the cell division and the elongation are inhibited, and the chlorophyll synthesis is reduced. The plant is short, small, fine and weak, the leaf color is yellow, the growth cycle is delayed, and the fruiting rate is low. When the nitrogen content is excessive, a large amount of carbohydrate can be used for synthesizing substances such as protein, chlorophyll and the like, so that cellulose and pectic substances in cell walls are greatly reduced, and plant cells are large and thin in wall and are easy to attack by diseases and insects. Meanwhile, the mechanical tissue of the stem is undeveloped and is easy to lodge. Therefore, research crops have important scientific and production significance for nitrogen absorption and utilization (Liu et al, 2022). Corn (Zea mays L.) is used as the first important grain crop and feed crop in China, has large production amount and high economic benefit, has edible, feeding and various industrial purposes, and has important strategic positions in the aspect of guaranteeing grain safety. Corn is a type of nitrogen-preferred crop, and the application of nitrogen fertilizer to farmlands increases significantly its yield, however, excessive application of nitrogen fertilizer also results in reduced crop utilization and causes environmental pollution problems (Hu et al, 2023). Development of nitrogen efficient corn varieties is an important issue to be addressed. However, how to improve the utilization rate of nitrogen fertilizer or to improve the nitrogen high-efficiency perception, absorption, assimilation and transportation of corn plants, and the excavation and molecular modules for excavating the corn nitrogen high-efficiency genes are important scientific problems to be solved in the current agricultural production. The nitrogen utilization efficiency of corn is directly related to the grain yield and biomass. When the corn lacks nitrogen, the plant is short, small, thin, yellow in leaf color, delayed in heading due to slow growth period, unable to develop normally, and severely reduced in yield. In the vegetative growth stage of corn, the root and stem leaves are responsible for absorbing nitrogen and assimilating and storing nitrogen compounds, and after the corn is transferred into the reproductive growth stage, the nitrogen stored in the stem leaves at the early stage is redistributed to seeds. The physiological and biochemical research on the corn nitrogen absorption, assimilation and redistribution process is enhanced, and the method has very important scientific value and production significance for improving the corn nitrogen utilization efficiency. At present, researches on efficient gene excavation and functional analysis of corn nitrogen are limited, reports on the research are few, and the efficient gene excavation and functional analysis of corn nitrogen are needed, so that theoretical support and germplasm resources are provided for efficient corn germplasm utilization of nitrogen. The research on the corn nitrogen regulation network is not deep, and few reports are related. The wild corn high protein gene THP9 is cloned in 2022, and codes asparagine synthetase 4 (ASN 4) gene, so that the protein content in inbred lines and hybrid seeds can be improved in tomorrow, and meanwhile, the gene has a nitrogen high efficiency function, which shows that the seed protein content and the nitrogen utilization efficiency are two coupling characters which are genetically connected through a nitrogen utilization process (Huang et al, 2022). The expression of nitrogen-related genes can be restored after 9 NLP (NIN-like protein) genes, zmNLP and ZmNLP are transferred into the NLP-4 mutant of Arabidopsis thaliana (Cao et al, 2017) are contained in corn. Overexpression of zmnlp3.1 in arabidopsis can increase main root le