Search

CN-121992029-A - Method for inducing antibacterial peptide to express resistance to yellow dragon disease by transforming citrus with Drosophila Drosocin gene

CN121992029ACN 121992029 ACN121992029 ACN 121992029ACN-121992029-A

Abstract

The invention discloses a method for transforming citrus by utilizing Drosophila Drosocin genes to induce antibacterial peptides to express resistance to yellow dragon disease, which relates to the technical field of forest breeding and seedling raising, and comprises the steps of introducing Drosophila Drosocin genes into a citrus receptor material, inducing Drosocin antibacterial peptides to express, and obtaining the citrus material for resisting the yellow dragon disease, wherein the nucleotide sequence of the Drosophila Drosocin gene is shown as SEQ ID NO. 1. According to the invention, the Drosophila Drosocin gene is introduced into the citrus acceptor material to induce Drosocin antimicrobial peptide to express, so that the citrus material for resisting the citrus yellow long disease is obtained, the purposes of inhibiting the proliferation of the citrus yellow long disease and providing a green and efficient means for preventing and controlling the citrus yellow long disease are achieved.

Inventors

  • ZHOU CHANGYONG
  • DENG XINYI
  • He Haoning
  • ZHU ZHOUYING

Assignees

  • 西南大学

Dates

Publication Date
20260508
Application Date
20260325

Claims (10)

  1. 1. A method for transforming citrus by using Drosophila Drosocin genes to induce antibacterial peptide to express against yellow dragon disease is characterized by comprising the steps of introducing Drosophila Drosocin genes into a citrus receptor material, inducing Drosocin antibacterial peptide to express, and obtaining the citrus material against yellow dragon disease, wherein the nucleotide sequence of the Drosophila Drosocin genes is shown as SEQ ID NO. 1.
  2. 2. The method for inducing expression of antimicrobial peptides against yellow dragon disease by transforming citrus with Drosophila Drosocin gene as claimed in claim 1, wherein the amino acid sequence of Drosocin antimicrobial peptide is shown in SEQ ID NO. 2.
  3. 3. A method for transforming citrus plants with drosophila Drosocin gene to induce expression of antimicrobial peptides against yellow dragon disease according to claim 1 or 2, wherein drosophila Drosocin gene is introduced into citrus plant material by means of recombinant expression vector pNM-GFP-Drosocin.
  4. 4. A method for inducing expression of antimicrobial peptides against yellow dragon disease by transforming citrus with drosophila Drosocin gene according to claim 3, wherein the recombinant expression vector is introduced into citrus receptor material by agrobacterium-mediated method, and the agrobacterium is agrobacterium K599 strain.
  5. 5. A method for inducing expression of anti-yellow dragon disease by transforming citrus with drosophila Drosocin gene according to claim 4, wherein the agrobacterium-mediated method comprises culturing agrobacterium containing recombinant expression vector to logarithmic phase, centrifugally collecting thallus, preparing agrobacterium suspension by resuspension with induction buffer, co-culturing citrus explant with the agrobacterium suspension, the co-culturing infecting citrus explant with agrobacterium, inducing culture to form hairy root, and expressing Drosocin antibacterial peptide.
  6. 6. The method for inducing the expression of antimicrobial peptides against yellow dragon disease using Drosophila Drosocin gene transformed citrus as claimed in claim 5, the induction buffer comprises MES that regulates the pH of the agrobacterium suspension that induces the agrobacterium to express the Vir genes.
  7. 7. The method for inducing antibacterial peptide expression against yellow dragon disease by using Drosophila Drosocin gene transformed citrus as claimed in claim 5, wherein the stem segments are cut to form wounds after surface disinfection, and the co-culture adopts vacuum infiltration treatment, and the vacuum infiltration treatment enables the agrobacterium suspension to enter the stem segment tissues.
  8. 8. A method for inducing the expression of antimicrobial peptides against yellow dragon disease by transforming citrus with Drosophila Drosocin gene according to claim 3, further comprising the steps of molecular identification of the obtained citrus material, wherein the molecular identification comprises extracting genomic DNA of the citrus material, PCR amplification by using primer pNM-GFP-Drosocin-F and primer pNM-GFP-Drosocin-R, detecting the Drosophila Drosocin gene, and real-time fluorescence quantitative reverse transcription polymerase chain reaction by using primer RT-Drosocin-F and primer RT-Drosocin-R after extracting total RNA of the citrus material, detecting the transcription level of the Drosophila Drosocin gene; The nucleotide sequence of the primer pNM-GFP-Drosocin-F is as follows: tttggagaggacagggtaccatgGGCAAACCGCGTCCGTATT; the nucleotide sequence of the primer pNM-GFP-Drosocin-R is as follows: gggaattcctgcaggtcgacTTAAACACGAATTGGACGAGGAT; The nucleotide sequence of the primer RT-Drosocin-F is as follows: atgGGCAAACCGCGTCCGTATT; the nucleotide sequence of the primer RT-Drosocin-R is as follows: TTAAACACGAATTGGACGAGGAT。
  9. 9. A method for inducing expression of antimicrobial peptides against yellow shoot disease by transforming citrus with drosophila Drosocin gene according to claim 1, further comprising performing resistance evaluation of yellow shoot disease on the obtained citrus material, wherein the resistance evaluation comprises inoculating yellow shoot bacteria with the citrus material, extracting DNA after culturing, and detecting the colonization level of CLas by quantitative polymerase chain reaction.
  10. 10. A method of inducing expression of antimicrobial peptides against yellow dragon disease using drosophila Drosocin gene transformation of citrus as claimed in claim 1 wherein the citrus material is transgenic hairy root expressing Drosocin antimicrobial peptide.

Description

Method for inducing antibacterial peptide to express resistance to yellow dragon disease by transforming citrus with Drosophila Drosocin gene Technical Field The invention relates to the technical field of tree breeding and seedling raising, in particular to a method for transforming citrus by using Drosophila Drosocin genes to induce antibacterial peptide to express resistance to yellow dragon disease. Background Citrus is used as a world-wide cash crop of great importance and also stabilizes the treasury of the largest fruit in the world. Over ten years ago, the planting area of the citrus is continuously expanded, and the yield is steadily increased. The positive development situation not only promotes the prosperity of the global fruit industry, but also injects continuous power for the economic trade development in the south China. In the national economy system of China, the citrus industry occupies a key and irreplaceable important position by virtue of huge industrial scale, wide industrial association and remarkable economic benefit, and is one of the prop industries with great vitality and potential in the agricultural economy field. In the process of the rapid development of the citrus industry, the citrus industry encounters frequent invasion of a plurality of diseases, and the diseases seriously threaten the stable and sustainable development of the industry. Among them, citrus yellow dragon disease is a destructive disease caused by bacteria of the genus phloem (Candidatus Liberibacter spp., abbreviated as Clas), and is visually called "citrus cancer" in the field of citrus diseases. The symptoms of the citrus tree are extremely complex and various, and the early stage may only show slight symptoms such as leaf yellowing, plant growth retardation and the like, but the withering and death of the whole citrus tree can be gradually caused along with the gradual progress of the disease. More seriously, the citrus yellow dragon disease has the characteristics of high transmission speed and high mortality rate, and pathogenic bacteria Clas of the citrus yellow dragon disease cannot be purely cultured on an artificial culture medium at present, so that great difficulty is brought to disease diagnosis, research and prevention and control work. The antibacterial peptide (Antimicrobial Peptides, AMPs) is taken as an important component of the innate immune system of organisms, and has unique biological characteristics and wide application prospect. The small molecule polypeptide has broad-spectrum bactericidal activity, can play a role in inhibiting or killing various pathogenic microorganisms, and covers bacteria, fungi, partial viruses and the like. Compared with the traditional antibiotics, the antibacterial peptide has more complex and diversified action mechanisms, is not easy to cause the pathogen to generate drug resistance, and has remarkable advantages in the aspect of coping with the increasingly serious problem of antibiotic drug resistance. Based on these characteristics of the antimicrobial peptide, the antimicrobial peptide is widely applied in various fields including medicine, food preservation, prevention and control of agricultural diseases and the like. In the field of plant disease prevention and control, the antibacterial peptide from plant sources and microorganism sources has certain potential in the aspects of inhibiting the growth of plant pathogenic bacteria, enhancing the disease resistance of plants and the like due to the natural affinity of the antibacterial peptide with plants. The antibacterial peptide from animal sources has stronger antibacterial activity and stability due to the unique amino acid composition and structural characteristics, and gradually becomes an important research direction for developing novel biopesticide. The long-term, large-scale use of chemical pesticides is a significant problem in conventional control systems for citrus diseases. Although chemical pesticides can effectively control the spread and spread of diseases in a short period of time, pathogens gradually develop antibiotic resistance to chemical pesticides with prolonged use time and increased frequency. The control effect of chemical pesticides is gradually reduced, and the dosage and frequency of the pesticides are required to be continuously increased, so that a vicious circle is formed, the drug resistance problem of pathogens is further aggravated, serious pollution is caused to the ecological environment, and the health and ecological balance of human beings are threatened. The cultivation of disease-resistant varieties is another traditional disease prevention and control strategy, but the method has obvious limitations. The breeding of disease-resistant varieties often needs to be subjected to multi-generation hybridization breeding and field experiments, the breeding period is long, and the new varieties with stable disease resistance can be cultivated usually in a period of y