CN-121992062-A - Experimental method for researching influence of TRPC5 on drug resistance of tumor cells temozolomide through mitochondrial autophagy pathway
Abstract
Through extensive and intensive research, the invention discovers that a novel path Parkin/Park/Mul1/Mfn2 for TRPC5 to regulate and control the drug resistance of a tumor chemotherapy Temozolomide (TMZ) drug has close relation with the drug resistance generation of the tumor chemotherapy Temozolomide (TMZ) drug. The expression level of TRPC5 in temozolomide-tolerant cells U87R, U251R is significantly elevated compared to primary cells U87, U251, and the mitochondrial autophagy pathway is activated. Reducing the expression of TRPC5 gene can enhance the sensitivity of cell strain to temozolomide drug and inhibit the proliferation capability of tumor cells. The invention not only provides new data for the drug resistance mechanism of malignant glioma, but also provides new targets for the design of anti-tumor drug resistance drugs.
Inventors
- ZHAO XUDONG
- ZOU YAN
- ZHU YI
- ZHANG YUANHAI
- ZHANG YATING
- TIAN JIAJIA
Assignees
- 无锡市第二人民医院
Dates
- Publication Date
- 20260508
- Application Date
- 20251231
Claims (3)
- 1. An experimental method for studying the influence of TRPC5 on temozolomide resistance of tumor cells through a mitochondrial autophagy pathway, comprising the steps of: step 1, cell culture: Both U87 and U251 cells were cultured with DMEM-H containing 10% fetal bovine serum and glutamine and sodium pyruvate, and placed in a 37℃and 5% C02 incubator; Exposing the U87 cells and the U251 cells to temozolomide at a specific high concentration, culturing drug resistant cells U87R and U251R cells, culturing the cells by using a culture medium containing 400 mu M TMZ, and carrying out passage, wherein the U87 cells and the U251 cells are treated by using DMSO in the same manner as a drug resistant control; Step 2, cell line drug resistance analysis: Preparing single cell suspension from cells by using culture solution containing 10% fetal bovine serum, inoculating 1000 cells per well into a 96-well plate, culturing for 3-5 days in a constant temperature incubator with the concentration of 200 mu L per well at 37 ℃ and 5% CO2, adding 10 mu L of MTT solution per well, preparing 5mg/ml with PBS (phosphate buffer solution), keeping incubating for 4 hours, stopping culturing, sucking and removing culture supernatant in the well, adding 100 mu LDMSO per well, oscillating for 10min to enable crystals to be fully dissolved, selecting 490nm, measuring the light absorption value of each well on an enzyme-linked immunosorbent assay, recording the result, drawing a cell growth curve with the concentration as the abscissa and the light absorption value as the ordinate, calculating an IC50 value through the curve, and repeating the above experiment for 3 times; step 3, real-time quantitative PCR analysis of TRPC5 expression in each cell line: After extracting total RNA from a sample with a reagent and quantifying it by NanoDrop 2000, reverse transcription operation was performed according to the instructions using 200ng total RNA with REVERTRA ACE QPCR RT KIT, real-time quantitative PCR amplification with the following primers, TRPC5 gene coding region primers: TRPC5 Forward:5’-TGAACTCCCTCTACCTGGCAAC-3’,SEQ ID NO.1, Reverse:5’- CGAAGAGTGCTTCCGCAATCAGT -3’,SEQ ID NO.2, GAPDH Forward:5’-AACAGCCTCAAGATCATCAGC-3’,SEQ ID NO.3, Reverse:5’-GGATGATGTTCTGGAGAGCC-3’,SEQ ID NO.4; The PCR reaction parameters are 95 ℃ for 5min, 95 ℃ for 30sec,59 ℃ for 30sec and 72 ℃ for 30min for 40 cycles, a dissolution curve is drawn from 70 ℃ to 95 ℃, the experiment is repeated three times, GAPDH is used as an internal control, and the difference of the expression level of the target gene TRPC5 between the groups is calculated by a 2-delta Ct method; step 4, western Blot analysis of TRPC5 expression in each cell line: Taking cultured cells growing to a logarithmic phase, using fresh cell lysate containing protease inhibitors, lysing the cells to extract total protein, using a Bradford method of Bio-Rad company to measure protein concentration, adding 4 mug protein into each lane, calculating the volume of the cell protein, adding 5 XSDS loading buffer solution according to the proportion of 1:4 to dissolve the protein, denaturing for 5min at 100 ℃, immediately placing the cell on ice for 5min, carrying out short-time rapid centrifugation, carrying out electrophoresis after loading, firstly, carrying out electrophoresis at 80V until bromophenol blue dye enters separation gel, then adjusting the voltage to 120V, continuing to carry out electrophoresis until bromophenol blue reaches the bottom of the gel, carrying out electrotransfer of 70min protein by using a Bio-Rad electrophoresis apparatus at 120mV constant pressure, transferring the separated protein onto a nitrocellulose filter membrane, using 5% skimmed milk prepared by PBST solvent to seal for 2h at room temperature, incubating primary antibody for 4h by using PBST for 3 times, incubating the primary antibody for 15min each time, and carrying out dilution of horseradish peroxidase labeled anti-rabbit antibody and mouse secondary antibody in 5% skimmed filter membrane by 1:4000, incubating the PBST for 3 times, carrying out chemical fixation for 3 times, carrying out X-ray film washing, and carrying out chemical fixation, and carrying out analysis after the development, and carrying out the analysis of luminous fixation; step 5, screening high-efficiency siRNAs fragments interfering with TRPC 5: designing and synthesizing a transient interference oligonucleotide sequence for the TRPC5 gene, that is to say, the nucleotide sequence of the sense strand of siRNA for the TRPC5 gene is shown as SEQ ID NO.5; CCAAUGGACUGAACCAGCUUUACUU; the nucleotide sequence of the antisense strand of the siRNA is shown as SEQ ID NO.6, and specifically comprises the following steps: UGUCGUGGAAUGGAUGAUAUU; Setting NC group, U87R/U251R cell is not treated, TMZ group, U87R/U251R cell is added with 100 mu MTMZ, si-TRPC5+TMZ group, U87R/U251R cell is transfected with si-TRPC5, and 100 mu M TMZ is added, 24 hours before transfection, U87R/U251R cell in logarithmic growth phase is taken, pancreatin digestion is carried out, complete culture medium is added for resuspension, suction tube blowing and mixing are carried out to prepare cell suspension, cell is inoculated into 6 hole plate according to cell concentration of 1X 106 cells/hole, 37 ℃ is placed in a 5% CO2 incubator for culturing for 18-24 hours, each hole cell before transfection reaches 80% -90% confluence rate, 3 hours before transfection, original culture medium is removed, fresh basic culture medium without serum and antibiotics is replaced, liposome Lipofectne 3000 is adopted, transfection is carried out according to a kit instruction, and culturing is carried out for 48 hours under the conditions of 37 ℃ and 5% CO 2; step 6, analyzing the expression condition of the Parkin/Park/Mul1/Mfn2 channel after the siRNA interferes with the TRPC5 by using WesternBlot; After the glioma cells growing to the logarithmic phase are transfected for 48 hours, total protein is extracted from the cells by using fresh cell lysate containing protease inhibitor, the protein concentration is measured by using a Bradford method of Bio-Rad company, 4 mug protein is added to each lane, the cell protein volume is calculated, 5 XSDS loading buffer is added according to the ratio of 1:4 to dissolve the cell protein volume, the cell protein is denatured for 5 minutes at 100 ℃, the cell protein is immediately placed on ice for 5 minutes, the cell protein is subjected to transient rapid centrifugation, electrophoresis is performed after loading, firstly, the cell protein is subjected to electrophoresis at 80V until bromophenol blue dye enters into separation gel, then the cell protein is subjected to electrophoresis until bromophenol blue reaches the bottom of the gel by adjusting the voltage to 120V, and the Bio-Rad electrophoresis apparatus is subjected to electrotransfer of protein for 70 minutes by 120mV constant voltage, so that the separated protein is transferred onto a nitrocellulose filter membrane. The filter membrane is sealed by 5% skimmed milk prepared by PBST solvent at room temperature for 2h, the primary antibody is incubated by a reverse pasting method for 4h, the primary antibody is washed by PBST for 3 times after incubation, each time for 15min, horseradish peroxidase-marked anti-rabbit and mouse secondary antibodies are diluted in 5% skimmed milk at a ratio of 1:4000, the filter membrane Ih is incubated at room temperature, the PBST is washed for 3 times each time for 15min, ECL chemiluminescence, X-ray film exposure and development and fixation are carried out after membrane washing, and the Mul1 and MFN2, and the Parkin/Park/Mul1/Mfn2 expression quantity is analyzed.
- 2. The experimental method for studying the effect of TRPC5 on temozolomide resistance of tumor cells through the mitochondrial autophagy pathway according to claim 1, further comprising the steps of: Step 7, siRNA interfering with TRPC5 expression can reverse the sensitivity of tumor cells to TMZ, and reduce the cell proliferation rate; After cell transfection, cells in logarithmic growth phase were taken, digested with trypsin solution and blown into single cells, then RPMI1640 medium was added, after centrifugation, cells were prepared into single cell suspension with 10% fetal bovine serum in culture medium, 1000 cells per well were inoculated into 96-well plates, each well was incubated in a constant temperature incubator at 200 μl,37 ℃ and 5% co2 for 24h, si-TRPC5 or control group was added for 3-5 days, 100 μl MTMZ was added for 24h, MTT solution was added per well, 5mg/ml was prepared with PBS, ph= 7.4,10 μl was continued to incubate for 4h, culture was terminated, in-well culture supernatant was carefully aspirated, suspended cells were required to be centrifuged and re-aspirated, 100 μ LDMSO was added per well, shaking was performed for 10min, crystals were sufficiently dissolved, 490nm was selected, light absorption values for each well were measured on an enzyme-linked immunosorbent monitor, the results were recorded, cell growth curves were plotted on the ordinate with light absorption values as the abscissa, and IC50 values were calculated by the curve, and experiments were repeated 3 times.
- 3. The experimental method for studying TRPC5 effect on temozolomide resistance of tumor cells through mitochondrial autophagy pathway according to claim 2, further comprising the steps of: step 8, constructing a glioma nude mouse model: firstly, after a glioma cell strain is treated by TRPC5-shRNA, the glioma cell strain is planted under the skin of a nude mouse at a density of 5 multiplied by 106 to construct a glioma nude mouse model, temozolomide is orally taken every day, tumor tissues are collected after 5 weeks, the size, weight and the like of tumor formation are detected, and the relationship between the tumor tissue and the survival rate of a control group is compared.
Description
Experimental method for researching influence of TRPC5 on drug resistance of tumor cells temozolomide through mitochondrial autophagy pathway Technical Field The invention belongs to the technical field of medicines, and particularly relates to an experimental method for researching the influence of TRPC5 on the drug resistance of tumor cells temozolomide through a mitochondrial autophagy pathway. Background Gliomas refer to tumors that originate from glial cells, the most common primary intracranial tumor. Brain gliomas are classified into astrocytomas, oligodendrocytomas, ependymomas, and hybrid gliomas according to the degree to which their tumor cell morphology is similar to that of normal brain gliomas. The grading system established by the World Health Organization (WHO) can classify gliomas from grade 1 (lowest malignancy, best prognosis) to grade 4 (highest malignancy, worst prognosis). Among them, traditional cytopathology called anaplastic gliomas correspond to WHO grade 3, glioblastoma corresponds to WHO grade 4. According to the grading system, brain gliomas can be further classified into low-grade gliomas (WHO 1-2 grade) and high-grade gliomas (WHO 3-4 grade) according to the pathological malignancy of tumor cells. Statistics at the united states brain tumor registry (CBTRUS) show that gliomas account for approximately 27% of all central nervous system tumors, accounting for 80% of malignant tumors. Surgery is often the first step in glioma treatment, and for some low grade gliomas, such as hairy cell astrocytomas, complete resection of the surgery allows patients to be cured and survive for a long period of time. However, for high grade glioma patients, further chemotherapy is often required. Temozolomide (TMZ) is an oral alkylating agent which can pass through the blood brain barrier to reach the focus, and is one of the first-line common medicines for clinically treating glioma. Gliomas are difficult to cure radically and often recur. Studies have shown that the effective rate of treatment of human gliomas with TMZ is about 45%, with brain glioma resistance to TMZ being the leading cause of chemotherapy failure. Therefore, we have urgent need to find a viable therapeutic strategy for gliomas. In the prior art, some methods for verifying the drug resistance of TMZ in gliomas are disclosed, but only a plurality of paths are disclosed in those methods, so that in order to explore the optimal treatment scheme, experiments are still required to be designed, and the expression of the drug resistance of TMZ in gliomas under other paths is explored. Disclosure of Invention The invention utilizes real-time quantitative PCR and Western Blot to find that the expression of TRPC5 in malignant glioma TMZ drug-resistant cell strains (U87R and U251R) is increased relative to the parent sensitive cell strain. Further, the present invention has found that the resistance of U87R and U251R cell lines to TMZ can be partially reversed by decreasing the expression level of TRPC5 using siRNA interference technology. Therefore, the TRPC5 gene is first proposed to be a malignant glioma cell TMZ drug resistance related gene. In addition, after TRPC5 expression was inhibited, the activation level of the mitochondrial autophagy pathway was also significantly decreased, suggesting that TRPC5 genes may play a role by affecting the expression of the downstream mitochondrial autophagy pathway. TRPC5 TRPC5 (TRANSIENT RECEPTOR POTENTIAL CHANNEL, TRPC 5) is a cell membrane transmembrane calcium ion channel, genebank number ng_021215.1 for TRPC 5. TRPC5 inhibitors refer to molecules having an inhibitory effect on TRPC 5. The inhibition effect on TRPC5 includes, but is not limited to, inhibition of TRPC5 activity, or inhibition of TRPC5 gene transcription or expression, and inhibition of TRPC5 protein level. The TRPC5 inhibitors include, but are not limited to, siRNA, shRNA, antibodies, small molecule compounds. Inhibiting TRPC5 activity refers to decreasing TRPC5 activity. Preferably, TRPC5 activity is reduced by at least 10%, preferably by at least 30%, more preferably by at least 50%, even more preferably by at least 70%, even more preferably by at least 80%, most preferably by at least 90% compared to that prior to inhibition. Inhibiting TRPC5 gene transcription or expression refers to rendering the TRPC5 gene non-transcribed, or reducing the transcriptional activity of the TRPC5 gene, or rendering the TRPC5 gene non-expressed, or reducing the expression activity of the TRPC5 gene. Conventional methods can be used by those skilled in the art to regulate gene transcription or expression of TRPC5, such as gene knockout, homologous recombination, interfering RNA, and the like. Inhibition of gene transcription or expression of TRPC5 can be verified by PCR and Western Blot detection of the expression level. Preferably, TRPC5 gene transcription or expression is reduced by at least 10%, preferably by at least 30%, more preferably b