Search

CN-121992070-A - Molecular biology technology-based method for identifying single-component perfume raw materials in perfume base

CN121992070ACN 121992070 ACN121992070 ACN 121992070ACN-121992070-A

Abstract

The invention discloses a method for identifying single-component perfume raw materials in perfume bases through a molecular biological technology. The method is to extract DNA of the perfume raw material in the perfume base for the first time by utilizing a molecular biological method, and identify the target perfume raw material by a specific PCR amplification technology. For the perfume-based raw material sample which is difficult to process, a modified CTAB method is combined with an anion column purification DNA extraction method to obtain high-quality DNA for PCR reaction. The invention can accurately detect the existence of plant-derived perfume raw materials in the perfume base, has high specificity, high sensitivity and wide application potential, simplifies the detection process and greatly reduces the cost.

Inventors

  • WEN JIANHUI
  • Dong Daozhu
  • FENG YE
  • LUO WEI
  • DU WEN
  • GAO JUNPING

Assignees

  • 湖南中烟工业有限责任公司

Dates

Publication Date
20260508
Application Date
20241108

Claims (7)

  1. 1. A method for identifying single-component perfume raw materials in perfume bases based on molecular biology technology is characterized by comprising the steps of extracting perfume raw material DNA and detecting by PCR reaction.
  2. 2. The method according to claim 1, wherein the step of extracting the perfume raw material DNA comprises the steps of: (1) Adding 2g of a fragrance-based raw material into a centrifuge tube, and swirling to fully disperse a sample; (2) Adding 4 mu L of 10mg/ml RNaseA into a centrifuge tube, and standing for 5min at normal temperature after vortex mixing; (3) Adding 40 mu L of 20 mg/mL protease K into the mixture, incubating at 50 ℃ for 1h, and shaking and mixing for many times during the incubation process; (4) Adding 500ul of lysate at 60 ℃ for 30min, adding 700 ul of chloroform into a centrifuge tube, and vigorously vortex and mix for 30 seconds, wherein the lysate formula is 2% CTAB,100 mmol/L Tris-HCl with pH of 8.0, 20 mmol/L EDTA and 1.4mol/L NaCl; (5) Centrifuging at 12,000rpm at room temperature for 5 minutes, separating the solution into three layers, carefully transferring the supernatant into a new 2ml centrifuge tube, and enriching the supernatant by 5 tubes; (6) Adding isopropyl alcohol with the same volume, reversing the centrifuge tube upside down, and fully and uniformly mixing; (7) Transferring the solution to an anion exchange column, centrifuging at 12000rpm at room temperature for 1 min, and discarding the filtrate; (8) Adding 500 μl of 75% ethanol rinse solution to the anion exchange column, rinsing twice, and centrifuging at 12,000rpm at room temperature for 1 minute; (9) Placing the anion exchange column in a new 2 ml collecting pipe, centrifuging and thoroughly airing a dry film; (10) The anion exchange column is placed on a new centrifuge tube of 1.5 ml, 50 μl of sterilized ultrapure water eluent is added at the center of the membrane, and after standing at 12000rpm, DNA is collected by 2min centrifugation, and the collected DNA can be directly used or put into-20 ℃ for preservation.
  3. 3. The identification method according to claim 1, wherein the PCR reaction system comprises the following components: Deionized H 2 O38 ul, 10 XTaq Buffer 5ul, dNTP Mix 1ul, template DNA 2ul, primer F2 ul, primer R2 ul, and total 50ul.
  4. 4. The method of claim 1, wherein the PCR reaction is performed by the following procedure: 95℃for 5min, 95℃for 30s, 61℃for 1min,72℃for 20s, 35 cycles, 72℃for 5min,4℃for less than 4h.
  5. 5. The method according to claim 1, wherein the agarose gel method used for detecting the result after the PCR reaction is prepared by 2% agarose gel, and electrophoresis is performed at a constant pressure of 120V for 30min after the gel is solidified.
  6. 6. The method according to claim 1, wherein the primers used in the PCR reaction are designed based on the plant from which the component to be detected is derived.
  7. 7. The method according to claim 6, wherein the primer pair sequences for detecting the hawthorn source component are as follows: haw-F:CGACCCGAGAACCAGTTTCA; haw-R:TCTTCATCGATGCGAGAGCC。

Description

Molecular biology technology-based method for identifying single-component perfume raw materials in perfume base Technical Field The invention belongs to the technical field of identification of components of perfume raw materials, and particularly relates to a method for identifying single perfume raw materials in perfume based on a molecular biology technology. Background In the flavoring process of cigarettes and foods, the flavor of single flavor and the use effect of the single flavor in the products are easy to grasp, and the composite functional flavor base obtained by compounding various single flavors according to a specific proportion has the effect of obviously improving the quality and sensory quality of the products. However, separation resolution and formulation identification of natural fragrance raw material characteristic chemical components face a number of complications. First, natural fragrance materials are very complex in chemical composition, including volatile and non-volatile components, water-soluble, alcohol-soluble and fat-soluble components, and typically one fragrance material contains thousands of ingredients or more. The composition of the components of the different materials varies greatly, so that individual analysis and analysis are required for each material. Second, some of the important components in natural fragrance raw materials may be present in very small amounts, possibly at concentrations of parts per million or even lower. Analysis of these micro-components requires highly sensitive analytical techniques and accurate separation and identification in complex sample matrices increases the difficulty of the experiment. Furthermore, interactions may exist between chemical components in natural fragrance raw materials, which may affect the accuracy of the analysis results. For example, certain components may be converted or decomposed with each other during sample preparation or analysis, resulting in errors in the analysis results. In addition, natural fragrance raw materials are often complex biological samples containing various compounds and impurities, such as oils, proteins, carbohydrates, and the like. These impurities can interfere with the analytical process and affect the separation and detection of the target compounds. In face of many challenges, an effective method for separating, analyzing and identifying characteristic chemical components of natural perfume raw materials and a formula is not available at present. Therefore, the traditional chemical analysis method has the problems of high identification difficulty and insufficient accuracy due to the complexity and diversity of the fragrance components. Therefore, the invention provides a method for identifying the single formula of the perfume raw materials in the perfume base based on the molecular biology technology for the first time, which can greatly simplify the detection process and save the cost of manpower and material resources while improving the accuracy, the sensitivity and the specificity. Since molecular biology techniques involve DNA extraction, in terms of extraction, although the CTAB method is currently the most common plant DNA extraction method, the quality and effect of the extraction can be affected by the sample state, resulting in the extracted DNA still possibly containing RNA, proteins or other contaminants, affecting subsequent DNA analysis or application. During the preparation process of the analyzed perfume raw materials, the analyzed perfume raw materials undergo various processes such as steaming, boiling, extracting or baking for a plurality of times, DNA in the raw materials can be damaged to different degrees, and food additives such as sugar, salt, oil, pigment, organic matters and the like can be additionally added, so that additional barriers are added to DNA extraction. The prior art method for extracting nucleic acid has the common problems that the concentration of the product is low, but the 260/280 difference between the fragrance raw materials in different states is large, the value is low, the pollution of protein, phenol and the like is shown, the extracted nucleic acid product is not clear and transparent, the color is brown caramel, and the impurities in the nucleic acid product can seriously influence the downstream reactions such as sequencing, PCR and the like. Disclosure of Invention The invention aims to solve the problems in the prior art and provides a method for identifying single-component perfume raw materials in perfume bases by using a molecular biology technology. The method is to extract DNA of the perfume raw material in the perfume base for the first time by utilizing a molecular biological method, and identify the target perfume raw material by a specific PCR amplification technology. Aiming at the perfume-based raw material sample which is difficult to process, a modified CTAB method is combined with an anion column purification DNA e