CN-121992079-A - Rapid detection method for echinococcus multilocularis based on RPA-CRISPR/Cas
Abstract
The invention discloses a rapid detection method of echinococcus multilocularis based on RPA-CRISPR/Cas, belonging to the technical field of molecular diagnosis. The method comprises the steps of extracting DNA of a sample to be detected, carrying out RPA isothermal amplification by using a specific primer, enabling a reaction system to comprise buffer solution, an upstream primer, a downstream primer, RPA enzyme, magnesium acetate and template DNA, reacting for 20 minutes at 39 ℃, mixing an amplified product with Cas12a protein, sgRNA and a fluorescent reporter probe, carrying out CRISPR/Cas reaction for 30 minutes at 37 ℃, and judging a result through a real-time fluorescent signal. The invention realizes constant-temperature rapid amplification by utilizing RPA, combines high specificity identification and cutting activity of CRISPR/Cas12a, can realize high-sensitivity and high-specificity detection of echinococcus multicamethyst under field conditions, has the sensitivity of up to unit copy number, is simple and convenient to operate, does not need complex instruments, and is suitable for basic medical treatment and field quarantine.
Inventors
- CAI QIGANG
- WANG LIPING
- WU XIAODONG
Assignees
- 青海省畜牧兽医科学院
Dates
- Publication Date
- 20260508
- Application Date
- 20260206
Claims (1)
- 1. The rapid detection method for echinococcus multilocularis based on RPA-CRISPR/Cas is characterized by comprising the following steps: S1, extracting DNA of a sample to be detected; S2, RPA amplification, namely configuring an RPA reaction system, and amplifying by an RPA method to obtain an amplified product; S3.CRISPR/Cas system reaction detection, namely taking the RPA amplification product, adding a fluorescent reporter probe, cas12a protein and sgRNA, carrying out CRISPR reaction detection, and reading a detection signal; Wherein the Cas12a protein is LbCas a, the RPA primer combination F5'-GGTTTGTTATGCGTTATGATTATT TGTTGCA-3' and R5'-CGACAACATAACATCACCAAAAATCAAGTAC-3', sgRNA have the sequence of UAAUUUCUACUAAGUGUAGAUUAACUGGAUUUAGGAGGUUGUUU, the fluorescent reporter probe has the sequence of 5'-TTATT-3', and the RPA amplification reagent comprises RPA enzyme and magnesium acetate; The reaction system for RPA amplification comprises an RPA buffer solution, ddH 2 O, an upstream primer, a downstream primer, RPA enzyme lyophilized powder, template DNA and magnesium acetate, wherein the reaction condition for RPA amplification is 39 ℃ reaction 20 min, the reaction system for CRISPR/Cas system reaction comprises 10X LbCas12a Reaction Buffer, lbCas12a, a template, a fluorescent reporter probe and sgRNA, and the reaction condition for CRISPR/Cas system reaction is 37 ℃ reaction 30 min; the proportion of each component of the RPA amplification reaction system is prepared according to the following proportion of 29.5 mu L of RPA buffer solution, 2.5 mu L of 280 mM magnesium acetate, 2.4 mu L of 10 mu M upstream primer, 2.4 mu L of 10 mu M downstream primer, 3 mu L of DNA template and RPA enzyme freeze-dried powder; The CRISPR/Cas system reaction system comprises the following components in proportion, wherein the proportion of each component of the reaction system is prepared according to the proportion of 2 mu L of RPA amplification products, 10X LbCas12a Reaction Buffer mu L,1 mu M LbCas a1 mu L of 10 mu M fluorescent reporter probes, 1 mu L of 1 mu M sgRNA and ddH2O to 20 mu L, and the reaction condition is that a real-time fluorescent quantitative PCR instrument is used for collecting FAM channel fluorescent signals every 30 s when a qPCR instrument is set to be 37 ℃ and 30 min.
Description
Rapid detection method for echinococcus multilocularis based on RPA-CRISPR/Cas Technical Field The invention relates to the technical field of molecular diagnosis, in particular to a method for rapidly detecting echinococcus multicamera disease based on combination of Recombinase Polymerase Amplification (RPA) and clustered regular interval short palindromic repeated sequences/CRISPR related proteins (CRISPR/Cas). Background Echinococcus multilocularis (Echinococcosis multilocularis) is a serious zoonotic parasitic disease caused by larvae (metacercaria) of Echinococcus multilocularis (Echinococcus multilocularis), and is widely popular in the temperate zone and the subfrigid zone of the world, and developed areas of the northwest and southwest animal husbandry and areas of the Qinghai-Tibet plateau in China are high-rise areas. The metacercaria has strong invasiveness and metastasis, is mainly parasitic in human livers (more than about 90 percent), can affect a plurality of organs such as lungs, brains, bones and the like, has hidden early symptoms, can cause liver tissue destruction, liver cirrhosis, jaundice and the like along with the proliferation and diffusion of worm bodies, endangers lives frequently due to organ failure or distant metastasis in the late stage, and has a disease death rate which is obviously higher than that of echinococcus granulosus. At present, the detection method of echinococcus multinomial disease has a plurality of limitations that the imaging detection (CT, ultrasonic and MRI) can only identify invasive focus with the diameter of more than 1cm, has insufficient sensitivity to early tiny focus (< 0.5 cm) and hidden metastasis focus, is difficult to distinguish from site-occupying lesions such as echinococcus granulosus, liver cancer and the like, the serological detection (ELISA, western Blot) relies on specific antigens of the echinococcus multinomial, is easy to cross react with parasites such as echinococcus granulosus, liver fluke and the like, the false positive rate reaches 12-18 percent, and can not meet the early screening requirement of asymptomatic infectious persons, the conventional PCR detection needs to rely on a real-time fluorescent quantitative PCR instrument to undergo a temperature cycling process of denaturation-annealing-extension, has complex operation and consumes 2-3 hours, has higher professional skill requirements for operators, is difficult to adapt to site quarantine of basic medical institutions and epidemiology investigation scenes in remote areas, and therefore, a detection method suitable for site, quick and accurate detection technology needs to be developed to solve the point of the existing detection technology. Disclosure of Invention Aiming at the defects of the echinococcus multilocularis detection method in the prior art, the invention provides a rapid detection method based on RPA-CRISPR/Cas, realizes high-specificity, high-sensitivity and constant-temperature rapid detection of the echinococcus multilocularis, and meets the requirements of clinical diagnosis and on-site quarantine. The invention aims to provide a rapid detection method of echinococcus multilocularis based on RPA-CRISPR/Cas, which comprises the following steps: s1, extracting DNA of a sample to be detected; s2, RPA amplification, namely configuring an RPA reaction system, and amplifying by an RPA method to obtain an amplified product; S3, CRISPR/Cas system reaction detection, namely adding a fluorescent reporter probe, cas12a protein and sgRNA into the RPA amplification product to perform CRISPR reaction detection, and reading a detection signal; Wherein the Cas12a protein is LbCas a, the RPA primer combination F5'-GGTTTGTTATGCGTTATGATTATT TGTTGCA-3' and R5'-CGACAACATAACATCACCAAAAATCAAGTAC-3', sgRNA have the sequence of UAAUUUCUACUAAGUGUAGAUUAACUGGAUUUAGGAGGUUGUUU, the fluorescent reporter probe has the sequence of 5'-TTATT-3', and the RPA amplification reagent comprises RPA enzyme and magnesium acetate; The reaction system for RPA amplification comprises an RPA buffer solution, ddH 2 O, an upstream primer, a downstream primer, RPA enzyme lyophilized powder, template DNA and magnesium acetate, wherein the reaction condition for RPA amplification is 39 ℃ reaction 20 min, the reaction system for CRISPR/Cas system reaction comprises 10X LbCas12a Reaction Buffer, lbCas12a, a template, a fluorescent reporter probe and sgRNA, and the reaction condition for CRISPR/Cas system reaction is 37 ℃ reaction 30 min. The RPA amplification reaction system comprises 29.5 mu L of RPA buffer solution, 2.5 mu L of 280 mM magnesium acetate, 2.4 mu L of 10 mu M upstream primer, 2.4 mu L of 10 mu M downstream primer, 3 mu L of DNA template and RPA enzyme freeze-dried powder. The CRISPR/Cas system reaction system comprises the following components in proportion, wherein the proportion of each component of the reaction system is prepared according to the proportion of 2 mu L of RPA amplification