Search

CN-121992100-A - Premature fetal membrane premature rupture prediction marker based on maternal circulating exosome microRNA and application kit

CN121992100ACN 121992100 ACN121992100 ACN 121992100ACN-121992100-A

Abstract

The invention belongs to the technical field of gynecological disease prediction, and particularly relates to a premature rupture of membranes prediction marker based on maternal circulating exosome microRNA and an application kit. The invention screens out fetal membrane-derived exosomes hsa-miR-145-3p which can be detected in the plasma exosomes through collecting placenta, fetal membranes and plasma exosomes of pregnant women with premature birth and premature rupture of the fetal membranes for sequencing, and respectively illustrates the effects of cell sources and premature birth promotion at cell level and animal level, and finally illustrates the efficacy of the fetal membranes in predicting premature rupture of premature birth (AUC=0.833) by detecting the levels of fetal membranes hsa-miR-145-3p of pregnant women with premature birth 12 (+ 1) to 17 (+ 6) Zhou Muti. The method can be used for predicting pPROM high-risk groups in early and middle gestation stages through a noninvasive method, and has guiding significance for subsequent preventive intervention for the high-risk groups.

Inventors

  • LIN QIMEI
  • CAO JIASONG
  • SHEN YONGMEI
  • WANG SHUQI
  • CHANG YING
  • YU JING
  • LI XIAOHUI
  • WANG YIXIN

Assignees

  • 天津市中心妇产科医院

Dates

Publication Date
20260508
Application Date
20260407

Claims (6)

  1. 1. A premature fetal membrane premature rupture prediction marker based on maternal circulating exosome microRNA, which is characterized in that the premature fetal membrane premature rupture prediction marker is hsa-miR-145-3p; The nucleotide sequence of hsa-miR-145-3p is as follows: GGAUUCCUGGAAAUACUGUUCU,SEQ ID No.1。
  2. 2. The premature fetal membrane premature rupture prediction marker based on maternal circulation exosome microRNA according to claim 1, wherein the hsa-miR-145-3p is derived from peripheral blood plasma.
  3. 3. The precursor circulating exosome microRNA-based predictive marker for premature membrane premature rupture according to claim 1, wherein the expression level of hsa-miR-145-3p is positively correlated with the risk of premature membrane premature rupture.
  4. 4. Use of a marker for the preparation of a kit for predicting premature rupture of membranes of premature birth, wherein the marker is hsa-miR-145-3p.
  5. 5. The use of a marker according to claim 4 in the manufacture of a kit for predicting premature rupture of membranes of premature birth, wherein the kit comprises reagents for detecting the marker hsa-miR-145-3 p.
  6. 6. The use of a marker according to claim 4 for the manufacture of a kit for predicting premature rupture of membranes of premature birth, wherein the subject of the kit is a peripheral blood plasma sample from a female who is pregnant for from 12 weeks 1 day to 17 weeks 6 days.

Description

Premature fetal membrane premature rupture prediction marker based on maternal circulating exosome microRNA and application kit Technical Field The invention belongs to the technical field of gynecological disease prediction, and particularly relates to a premature rupture of membranes prediction marker based on maternal circulating exosome microRNA and an application kit. Background Premature labor refers to delivery of less than 37 weeks of gestation, and is one of the important reasons for high morbidity and mortality in perinatal period. Premature rupture of membranes (preterm prelabour rupture of the membranes, pPROM) is one of the major subtypes of spontaneous premature delivery (spontaneous preterm birth) and is characterized by spontaneous rupture of membranes before 37 weeks of gestation, which can lead to serious complications such as oligoamniotic fluid, prolapse of umbilical cord, intrauterine infection of fetus, respiratory distress of neonates, and long-term neurodevelopment, and has significant health hazard to infants and mother. pPROM is believed to be a typical fetal membrane-derived disorder (PMID: 28807394) whose occurrence is closely related to structural and functional abnormalities of the fetal membrane. According to pPROM related literature, no effective prediction mode exists at present, and research shows that: (1) Past history of premature birth or pPROM is associated with increased risk of spontaneous premature birth upon re-pregnancy, but lacks formal assessment of sensitivity and specificity, primarily for identifying people in need of intensive education and monitoring. (2) At 22-24 weeks of gestation, women with cervical length <25 mm are at about 2 times the risk of spontaneous premature birth (< 35 weeks) than women with normal cervical length (RR 2.0,95% CI 0.95-4.2). However, the pathophysiological process behind this anatomical change, such as "cervical shortening", cannot be judged (whether the cervical necking is short due to the initiation of uterine contraction or the secondary changes are caused by other factors, such as infection and pPROM caused by the weakness of the fetal membranes). (3) Various biomarkers have an auxiliary value for pPROM evaluation. Fetal fibronectin (fFN), beta-human chorionic gonadotrophin (beta-hCG) and the like can be used for supporting diagnosis after pPROM occurrence, and inflammatory markers such as C-reactive protein (CRP), C4A and SAA4 are helpful for predicting the concurrent Histological Chorionic Amniotis (HCA) of pPROM patients, wherein the serum CRP level within 72 hours before delivery has a prompt significance for identifying HCA without amnion infection. However, the application of the markers is obviously limited in that most of the markers are nonspecific indexes, different etiological subtypes such as infectious and aseptic inflammation are difficult to distinguish, the predicted sensitivity and specificity are insufficient, and meanwhile, the predicted value is limited in late pregnancy and early risk early warning cannot be realized. (4) The detection of inflammatory biomarkers such as pro-inflammatory cytokines and Matrix Metalloproteinases (MMP) in amniotic fluid through amniocentesis is an important laboratory basis for diagnosing pPROM patients with subclinical chorionic amniotis at present, and has high clinical prediction value. However, this technique is significantly limited in its wide clinical application due to its originality and complexity of operation, and lacks further exploration of the ability to identify and predict a particular subtype of aseptic inflammation. (5) Other researchers have attempted to construct predictive models based on multi-index federation. For example, prediction of premature labor (including pPROM) at early and mid gestation using multiple sets of data for plasma free DNA and free RNA revealed a leading direction for multiple sets of chemical integration. However, the method has obvious limitations of high technical threshold, difficult interpretation of biological significance of results, strict requirements on sample stability and wide clinical application Shang Yuan at present. Overall, pPROM's risk prediction is still in the exploration phase. Clinically, the exact biomarker that can accurately predict pPROM occurrences has not been established. The current research focuses on the exploration of pPROM and related biomarkers (such as specific inflammatory factors) mediated by infection, and compared with pPROM mediated by an important pathological mechanism of aseptic inflammation, the research of specific biomarkers is rare. In recent years, exosomes (exosomes) as extracellular vesicles having diameters of about 30 to 150nm have been demonstrated to be widely present in body fluids such as blood and urine, and can play an important role in maternal-fetal communication, inflammatory response and development of pregnancy complications by carrying various active molecules such as