Search

CN-121992106-A - Molecular marker related to detection of growth traits of seven hundred-made chickens and application thereof

CN121992106ACN 121992106 ACN121992106 ACN 121992106ACN-121992106-A

Abstract

The invention provides a molecular marker related to the growth trait of a seven-hundred-made chicken and application thereof, belongs to the technical field of gene detection, and is used for detecting genotypes related to the growth trait of the seven-hundred-made chicken and aims at evaluating and applying the molecular marker to the weight, body oblique length, keel length, shank circumference, chest width, chest depth and pelvis width of the seven-hundred-made chicken. The ZNF609 gene as a molecular marker has important significance for auxiliary breeding and accelerates the breeding process of local chicken breeds.

Inventors

  • SUN JUNLI
  • QIN SHISHAN
  • Bin Chengfeng
  • ZHANG LI
  • ZHANG BING
  • LIN JUNYUAN
  • Sun Ruyu
  • LU HUILIN
  • MA QINGYAN
  • QIN LIMEI

Assignees

  • 广西农业职业技术大学
  • 广东海洋大学

Dates

Publication Date
20260508
Application Date
20241029

Claims (8)

  1. 1. The molecular marker is characterized in that the molecular marker is a first molecular marker, a second molecular marker, a third molecular marker, a fourth molecular marker, a fifth molecular marker, a sixth molecular marker, a seventh molecular marker, an eighth molecular marker, a ninth molecular marker or a tenth molecular marker; The first molecular marker is a mutation site g.1207450C > T in a chicken ZNF609 gene sequence, and the genotype of the mutation site is CC, CT and TT; The second molecular marker is a mutation site g.1207474C > T in a chicken ZNF609 gene sequence, and the genotype of the mutation site is CC, CT and TT; the third molecular marker is a mutation site g.12074833G > A in a chicken ZNF609 gene sequence, and the genotype of the mutation site is GG, GA and AA; The fourth molecular marker is a mutation site g.1207513A > G in a chicken ZNF609 gene sequence, and the genotype of the mutation site is AA, AG and GG; The fifth molecular marker is a mutation site g.1207746C > T in a chicken ZNF609 gene sequence, and the genotype of the mutation site is CC, CT and TT; the sixth molecular marker is a mutation site g.1208274G > A in a chicken ZNF609 gene sequence, and the genotype of the mutation site is GG, GA and AA; The seventh molecular marker is a mutation site g.1209033T > C in a chicken ZNF609 gene sequence, and the genotypes of the mutation site are TT, TC and CC; the eighth molecular marker is a mutation site g.1209411C > T in a chicken ZNF609 gene sequence, and the genotype of the mutation site is CC, CT and TT; The ninth molecular marker is a mutation site g.1209525C > T in a chicken ZNF609 gene sequence, and the genotype of the mutation site is CC, CT and TT; the tenth seed is marked as a mutation site g.1209546C > T in the chicken ZNF609 gene sequence, and the genotypes of the mutation site are CC and CT.
  2. 2. The molecular marker related to the growth trait of the seven-hundred-way chicken of claim 1, wherein the primer set of the first molecular marker, the second molecular marker, the third molecular marker and the fourth molecular marker is as follows: F:GCCATAGTGGAGGCTTTGTGGC R:TGGTGGGAGAGTCGCAGAACCT。
  3. 3. The molecular marker related to the growth traits of seven hundred-way chicken according to claim 1, wherein the primer group of the fifth molecular marker is: F:GAGGAACAAGACGTACGTGG R:CAGGCGAAAGTGAGCCCTTC。
  4. 4. the molecular marker related to the growth traits of seven hundred-way chicken, as set forth in claim 1, wherein the sixth molecular marker primer set is: F:GCTGAAGTATCACCAGGCCCA R:GATCGCTTGTTTCCCCTCGGAA。
  5. 5. The molecular marker related to the growth trait of the seven-hundred-way chicken of claim 1, wherein the primer group of the seventh molecular marker and the eighth molecular marker is: F:GAGCCTTTCGCAGTCAACCC R:GGCGTACTGGTTGTAGTAGAGG。
  6. 6. The molecular marker related to the growth trait of the seven-hundred-way chicken of claim 1, wherein the primer group of the ninth molecular marker and the tenth molecular marker is: F:CGCAGAGCAAAGAGTCTCCCTA R:CACCCTTTGTCTCCACGGTCT。
  7. 7. A molecular marker related to detecting the growth trait of a seven hundred-way chicken as set forth in any one of claims 2-6, wherein the primer set is applied to detecting the growth trait of a chicken or molecular breeding of a chicken.
  8. 8. The use of a molecular marker related to the growth traits of seven hundred-way chickens according to claim 1, wherein the step of assisted chicken breeding is performed by using the molecular marker of claim 1.

Description

Molecular marker related to detection of growth traits of seven hundred-made chickens and application thereof Technical Field The invention relates to the technical field of gene detection, in particular to a molecular marker related to the detection of the growth traits of seven hundred-fold chicken and application thereof. Background The enlarged Qibailin chicken is a special geographical sign variety produced in the river basin city of Guangxi Zhuang nationality and the enlarged Yao nationality county, and is favored by local farmers and consumers because of the advantages of bright feather color, strong adaptability, thick feeding resistance, strong disease resistance, small body size, firm muscles, less subcutaneous fat, delicious meat quality, rich nutrition and the like. The ZHX family members comprise two C2H2 type zinc finger (Znf) motifs and five homologous domains belonging to class Znf of homeodomain transcription factors. Zinc finger protein 609 (zinc finger protein,609, ZNF609) is one of the zinc finger protein family members, which are often involved in various vital activities such as cell differentiation, proliferation, apoptosis, dry maintenance, etc. as transcription factors by regulating gene expression. As a new generation molecular marker with the most development potential, single nucleotide polymorphism (single nucleotide polymorphism, SNP) has the advantages of abundant site quantity, wide distribution range, strong genetic stability, rapid detection and the like, and is always paid attention to in the field of life science. The current methods commonly used in mutation detection include Sanger direct sequencing technology, PCR-CAPS technology, PCR-SSCP technology, etc. The prior study reports that the ZNF609 gene has a regulating effect on the growth and development of muscle, and the gene is located in the 10 # autosome and contains 7 obvious SNP loci, which can influence the birth weight and 365dW of beef cattle, thereby affecting the development of muscle and the deposition of intramuscular fat. In addition, researches show that the ZNF609 gene has potential advantages in aspects of inflammatory response, immune regulation and the like of sheep. At present, ZNF609 genes are mainly used for intensively researching varieties such as beef cattle, sheep and the like, relatively few researches are carried out on poultry, and researches on chicken ZNF609 genes and growth traits are not reported yet. Therefore, a molecular marker related to the detection of the growth traits of the seven-hundred-made chickens and application thereof are required to be designed. Disclosure of Invention The invention aims to provide a molecular marker related to the detection of the growth traits of seven hundred-made chickens and application thereof, and solves the technical problems that the researches on the ZNF609 genes and the growth traits of the chickens are not related yet. The research is to detect the genetic polymorphism of the ZNF609 gene in the seven-hundred-made chickens, discuss whether the genetic polymorphism is related to the growth traits on a molecular level, excavate molecular genetic markers obviously related to the growth traits of the seven-hundred-made chickens, improve the accuracy of breeding, and provide data support for molecular marker-assisted breeding and variety improvement of the seven-hundred-made chickens of local varieties in the future. In order to achieve the above purpose, the technical scheme adopted by the invention is as follows: detecting molecular markers related to the growth traits of the seven hundred-way chickens, wherein the molecular markers are a first molecular marker, a second molecular marker, a third molecular marker, a fourth molecular marker, a fifth molecular marker, a sixth molecular marker, a seventh molecular marker, an eighth molecular marker, a ninth molecular marker or a tenth molecular marker; The first molecular marker is a mutation site g.1207450C > T in a chicken ZNF609 gene sequence, and the genotype of the mutation site is CC, CT and TT; The second molecular marker is a mutation site g.1207474C > T in a chicken ZNF609 gene sequence, and the genotype of the mutation site is CC, CT and TT; the third molecular marker is a mutation site g.12074833G > A in a chicken ZNF609 gene sequence, and the genotype of the mutation site is GG, GA and AA; The fourth molecular marker is a mutation site g.1207513A > G in a chicken ZNF609 gene sequence, and the genotype of the mutation site is AA, AG and GG; The fifth molecular marker is a mutation site g.1207746C > T in a chicken ZNF609 gene sequence, and the genotype of the mutation site is CC, CT and TT; the sixth molecular marker is a mutation site g.1208274G > A in a chicken ZNF609 gene sequence, and the genotype of the mutation site is GG, GA and AA; The seventh molecular marker is a mutation site g.1209033T > C in a chicken ZNF609 gene sequence, and the genotypes of the mutation site are TT, TC and