Search

CN-121992126-A - RPA-LFD visualization method for detecting infection of fasciola hepatica of cattle and sheep

CN121992126ACN 121992126 ACN121992126 ACN 121992126ACN-121992126-A

Abstract

The invention belongs to the technical field of biological detection, and provides an RPA-LFD visualization method for detecting infection of fasciola hepatica of cattle and sheep. The invention designs a specific forward and reverse primer and a probe based on the fasciola hepatica 18S-ITS1 gene sequence or the highly specific region and the conserved region sequence of fasciola hepatica. The RPA-LFD method established by the invention has high detection sensitivity, good specificity and stable detection effect, does not have cross reaction with common intestinal parasites of cattle and sheep, including Japanese blood fluke and the like, has the minimum detection limit of 100 fg/mu L of genome and the minimum detection limit of 1.93 multiplied by 10 1 copies/mu L of standard plasmid. 30 The detection can be completed within a minute without complex and special instruments and equipment, the time consumption is short, the operation is simple, the method is rapid and accurate, the field portable visual rapid detection can be realized, and the method has clinical application value in the aspects of diagnosis and comprehensive prevention and control of the fasciola hepatica infection of cattle and sheep.

Inventors

  • ZHANG SHAOHUA
  • WANG SHUAI
  • CUI XIU
  • ZHAO YEPING
  • LIU ZHIYU

Assignees

  • 中国农业科学院兰州兽医研究所(中国动物卫生与流行病学中心兰州分中心)

Dates

Publication Date
20260508
Application Date
20260127

Claims (10)

  1. 1. An RPA-LFD primer and a probe for detecting fasciola hepatica of cattle and sheep are characterized in that the RPA-LFD primer comprises a forward primer and a reverse primer, and the primer sequence and the probe sequence are as follows: Forward primer FacF: TCGTAACAAGGTTTCCGTAGGTGAACCTGCGG, Reverse primer FacR: ATGGTCAAAGACCAGGTTATCAGTCCAACCCG, probe FacP234: TCATGTCATGCGATAAAAATTTGCGGACGGTATGCCTGGCTCATT。
  2. 2. the RPA-LFD primer and probe according to claim 1, wherein the specific fragment amplified by the RPA-LFD primer is located between 1948-2410 bp sites of the fagoda maxima 18S-ITS1 gene or between 150-612 bp sites of the fagoda hepatica, and the specific fragment sequence is shown as SEQ ID No. 1.
  3. 3. An RPA-LFD detection method for fasciola gigantica, which is characterized by comprising the following steps: (1) Extracting DNA of a sample to be detected; (2) And (3) carrying out RPA-LFD reaction by taking sample DNA as a template to obtain RPA amplicon, diluting the RPA amplicon by ddH 2 O, taking 50 mu L of the RPA amplicon, dripping the RPA amplicon into a colloidal gold test strip sample adding hole, and judging that the T line has a mauve strip.
  4. 4. The RPA-LFD detection method according to claim 3, wherein the RPA-LFD reaction is carried out by sequentially adding AD buffer, the forward primer FacF, the reverse primer FacR, the probe FacP, the DNA of the sample to be detected and ddH 2 O into a dry powder tube, adding B buffer into a tube cover, and carrying out instantaneous centrifugation, thereby obtaining RPA amplicon according to the RPA-LFD reaction condition, wherein the RPA-LFD reaction condition is that the reaction temperature is 30-45 ℃ and the reaction time is 2.5-25 min.
  5. 5. The method according to claim 4, wherein the forward primer FacF, reverse primer FacR and probe FacP are each 10. Mu.M, and the sample DNA concentration is 1 ng/. Mu.L.
  6. 6. The method for detecting RPA-LFD according to claim 4, wherein the reaction condition of RPA-LFD is a reaction temperature of 39 ℃ and a reaction time of 15 min.
  7. 7. The method of claim 3, wherein the RPA amplicon is diluted at 20-fold.
  8. 8. The application of the nucleic acid detection test strip in the rapid detection of the fasciola hepatica is characterized in that the nucleic acid detection test strip comprises the forward primer FacF, the reverse primer FacR and the probe FacP234 according to claim 1.
  9. 9. A kit for rapidly detecting fasciola gigantica, which is characterized by comprising the forward primer FacF, the reverse primer FacR and the probe FacP234 reagent of claim 1.
  10. 10. Use of the kit according to claim 9 for the detection of fasciola hepatica in cattle and sheep.

Description

RPA-LFD visualization method for detecting infection of fasciola hepatica of cattle and sheep Technical Field The invention belongs to the technical field of biological detection, and particularly relates to an RPA-LFD (reverse transcription-linear frequency domain) visualization method for detecting fasciola hepatica infection of cattle and sheep. Background Fasciolopsis is an important zoonosis, and is popular worldwide and has a wide range of parasitic hosts. The species of the distributed insects are mainly fasciola hepatica (Fasciola hepatica) and fasciola gigantica (F. gigantica) in the area of high incidence in China. The disease is classified as a neglected tropical disease by the world health organization, and is classified as three animal epidemic diseases by the agricultural rural department of China. The disease is mainly harmful to cattle and sheep in veterinary clinic, causes hepatitis and cholangitis, causes long-term nutritional disorder and production performance reduction of animals, and the like, has a young animal mortality rate of up to 100% in fasciola epidemic areas, and causes serious threat to the healthy development of animal husbandry and public health safety. Therefore, the diagnosis and detection capability of the fasciolopsis is still a key link and means for effectively preventing and controlling the parasitic diseases of cattle and sheep. In actual production, the traditional etiology inspection method (such as fecal egg inspection and dissecting inspection method) cannot meet the requirement of rapidly, sensitively and effectively monitoring fasciola. In addition, under the condition of light infection or less worm eggs, missed detection or misdiagnosis is easy to cause, and the analysis and identification of adults are accurate, but time and labor are wasted and the labor cost is high. With the development of large amounts of genomic data of parasites and the rapid development of molecular detection techniques, targeting DNA can detect animals with a high degree of specificity for clinical parasitic infection. The study proves that the detection of parasite nucleic acid in feces can timely find the infection cases of cattle and sheep, and the combination of parasite specific targets and molecular detection technology has become a new reference method for diagnosis and monitoring of veterinary clinical parasites. At present, various PCR techniques have high pathogen detection accuracy, but expensive equipment and instruments are required, and the reaction conditions are harsh and are only suitable for laboratory detection, so that the development of a simple, convenient, quick, specific and sensitive on-site instant detection method capable of detecting the fasciola hepatica infection is urgently needed. In recent years, the combination of recombinase polymerase amplification (Recombinase polymerase amplification, RPA) and lateral flow chromatography (Lateral flow dipstick, LFD) can achieve the purpose of immediate and rapid visual detection. The method has been widely used in the detection of various parasite pathogens, such as haemonchus contortus, schistosoma japonicum, toxoplasma gondii, etc. In the RPA-LFD reaction system, biotin (Biotin) is marked at the 5 'end of a reverse primer, 6-carboxyfluorescein (6-FAM) or Fluorescein Isothiocyanate (FITC) and other antigen marks are modified at the 5' end of a molecular probe, an exonuclease nfo recognition site (tetrahydrofuran, THF) is marked at the middle position (about 30 nt from the 5 'end), a polymerase blocking group (such as C3-spacer, amino, phosphate group and the like) is marked at the 3' end, the reaction-generated double-marked amplicon carrying FAM and Biotin can be combined with a gold-marked FAM antibody in LFD for transverse electrophoresis, and the Biotin antibody coated at a detection line captures the amplicon Biotin for color development, and the electrophoresis is carried out to a control line, so that the amplicon is combined with a special antibody coated on the control line for color development. The RPA-LFD reaction generally realizes the ultra-rapid amplification of the target DNA fragments at the constant temperature of 39-42 ℃, can complete the rapid detection of the amplified products within 30min, does not need expensive instruments and equipment, has simple operation, is rapid and sensitive, has detection conditions superior to those of conventional PCR, LAMP and the like, and is suitable for detecting the cultivation site by naked eyes. In addition, the method can accurately diagnose and individuate insect expelling before typical diseases of infected cattle and sheep do not appear, can effectively avoid occurrence of group drug resistance and epidemic diseases, provides powerful technical support for timely monitoring, preventing and controlling the fasciolopsis of cattle and sheep, and has better application prospect. In conclusion, the invention provides an RPA-LFD visualization method for d