CN-121992140-A - InDel molecular marker for predicting glucose and sorbitol content of peach fruits and application of InDel molecular marker
Abstract
The invention discloses an InDel molecular marker for predicting the content of glucose and sorbitol in peach fruits and application thereof, wherein the InDel molecular marker is inserted with a section of sequence GAACAGAA, the insertion position of the InDel molecular marker is Chr04:15518130, and when the InDel exists in the position, the content of the glucose and sorbitol in the peach fruits can be reduced to a significant level. The InDel molecular marker provided by the invention can be used for early prediction of glucose and sorbitol contents of peach fruits and identification of variety resources, can also be used for analysis and screening of genetic background of cultivated peaches and breeding of excellent single plants of peaches, and has wide application prospects.
Inventors
- ZHANG BO
- JIN XIANYAO
- LI XINZHAO
Assignees
- 浙江大学
Dates
- Publication Date
- 20260508
- Application Date
- 20260316
Claims (3)
- 1. An InDel molecular marker for predicting glucose and sorbitol contents of peach fruits is characterized in that the position of the InDel molecular marker is Chur 04:15518130, wherein a wild type genome base does not contain the sequence, and a mutant type is inserted into a fragment with the sequence of GAACAGAA at the position of Chur 04: 15518130.
- 2. The use of the InDel molecular marker of claim 1 as a marker in early prediction of glucose and sorbitol content of peach fruits and identification of variety resources.
- 3. The application according to claim 2, characterized in that the application is realized by the following steps: (1) Extracting genomic DNA of peach to be detected, namely collecting tender leaf, bud and other tissues of the peach, extracting total genomic DNA of the peach by adopting a CTAB method, and detecting the purity and concentration of the DNA for later use; (2) Designing a specific primer, namely designing a primer pair according to a conserved sequence at the upstream and downstream of an InDel molecular marker insertion site, wherein the primer sequence is as follows, an upstream primer F is CTTCCTGCTCGTCTCAGCTT, and a downstream primer R is CAACATGTCCCATAAAAATGGA; (3) PCR amplification, namely, taking genomic DNA as a template, carrying out PCR amplification by adopting the specific primer, wherein a PCR reaction system is 10 mu L, namely, DNA samples are 10-200 ng, 2X Flash KOD DyeMix mu L (TOYOBO) and 0.3 mu mol/L, ddH 2 O of each of the upstream primer and the downstream primer are complemented to 10 mu L, the PCR reaction parameters are that denaturation is carried out for 10 sec at 98 ℃, annealing is carried out for 5 sec, the PCR reaction is carried out for 30 sec for 35 times at 68 ℃, and the length of an amplified product is 816 bp, and the amplified product is stored at 4 ℃ for facilitating subsequent sequencing analysis; (4) Genotype determination, in which the PCR amplification product is subjected to Sanger sequencing, the genotype is determined by comparison with a reference sequence, and if an inserted sequence is present, it is predicted that the fruit glucose and sorbitol content is low, and if only a deletion type band is present, it is predicted that the fruit glucose and sorbitol content is high, the inserted genotype is (+/+) or (+/-).
Description
InDel molecular marker for predicting glucose and sorbitol content of peach fruits and application of InDel molecular marker Technical Field The invention relates to the fields of plant molecular biology, bioinformatics and plant molecular breeding, in particular to an InDel molecular marker for predicting glucose and sorbitol contents of peach fruits and application thereof. Background Peach (Prunus persica) is an important stone fruit tree of Prunus genus of Rosaceae family, is widely cultivated in global temperate and subtropical regions, and has extremely high economic value and nutritional value. Fruit quality is the heart of competition in the peach industry, wherein the content and proportion of saccharide components directly affect the mouthfeel, flavor and commodity value of the fruit. Glucose and sorbitol are important saccharide components in peach fruits, the content levels of the glucose and the sorbitol are closely related to sweetness and flavor coordination of the fruits, and the glucose and the sorbitol are also one of key indexes for measuring the quality of the peach fruits. Conventionally, the content of glucose and sorbitol in peach fruits is detected by chemical methods such as high performance liquid chromatography after the fruits are ripe, and the method has the defects of long detection period, high cost, fruit damage and the like. Meanwhile, peach is used as a perennial woody plant, the breeding period is as long as 10-15 years, traditional breeding depends on phenotype selection, accurate prejudgment on the sugar content of fruits is difficult to carry out in early stage, and the breeding efficiency is low and the resource waste is serious. Although some molecular markers related to the quality of peach fruits have been developed in the prior art, specific molecular markers for glucose and sorbitol content are still lacking, and the problems of insufficient detection accuracy, limited applicability and the like exist. Therefore, the development of high-efficiency and accurate molecular markers realizes the early prediction of the glucose and sorbitol contents of peach fruits, and has important significance for accelerating the breeding of high-quality varieties of peaches and improving the quality and efficiency of industries. Disclosure of Invention The invention aims to provide an InDel molecular marker for predicting the glucose and sorbitol contents of peach fruits. The InDel molecular marker is positioned at the position of Chr04:15518130, wherein the wild type genome base does not contain the sequence, and the mutant type is inserted with a segment of sequence GAACAGAA at the position of Chr04: 15518130. The InDel molecular marker provided by the invention is a specific insertion sequence GAACAGAA, and the insertion position is positioned at 15518130 bp of chromosome 4 (Chu 04) of a peach genome (the reference genome is Prunpersica-genome. V2.1). When the GAACAGAA insertion sequence exists in the locus of the peach genome to be detected, the insertion genotype (+/+) or (+/-) is judged, the content of glucose and sorbitol in the corresponding fruit is low, and when the insertion sequence does not exist in the locus, the deletion genotype (-/-) is judged, and the content of glucose and sorbitol in the corresponding fruit is high. The invention also aims to provide application of the InDel molecular marker as a detection marker in early prediction of glucose and sorbitol contents of peach fruits. The application is realized by designing a specific primer based on the InDel molecular marker, performing PCR amplification on the genomic DNA of the peach, performing Mulberry sequencing on a PCR product, judging whether the sequence is inserted into the 15518130 locus of the Chr04 according to the sequencing result, and further predicting the content of glucose and sorbitol. The method specifically comprises the following steps: 1. Extracting genomic DNA of peach to be detected, namely collecting tender leaves, buds and other tissues of the peach, extracting total genomic DNA of the peach by adopting a (CTAB method), and detecting the purity and concentration of the DNA for later use; 2. Designing a specific primer, namely designing a primer pair according to a conserved sequence at the upstream and downstream of an InDel molecular marker insertion site, wherein the primer sequence is as follows (can be adjusted according to the actual sequencing result) that an upstream primer F is CTTCCTGCTCGTCTCAGCTT and a downstream primer R is CAACATGTCCCATAAAAATGGA; PCR amplification, namely, taking genomic DNA as a template, carrying out PCR amplification by adopting the specific primer, wherein a PCR reaction system comprises 10-200 ng mu L of DNA sample, 2X Flash KOD DyeMix mu L (TOYOBO) and 0.3 mu mol/L, ddH 2 O of each of the upstream primer and the downstream primer, and the total amount of the PCR reaction system is 10 mu L. The PCR reaction parameters are that denaturation is carried