Search

CN-121992141-A - Molecular marker related to wheat harvest index and application thereof

CN121992141ACN 121992141 ACN121992141 ACN 121992141ACN-121992141-A

Abstract

The invention belongs to the technical field of biology, and discloses a molecular marker related to wheat harvest index and application thereof. The present invention finds a Quantitative Trait Locus (QTL) for controlling the harvest index of wheat, designated QTL 4D-2, which is located within the interval of 21.0-22.0 Mb of the wheat 4D chromosome. In this interval we developed a core KASP marker Ta_Chr4D_22018842 (physical position: 4D: 22018842) that is closely linked to the trait of interest. The marker shows extremely remarkable correlation with wheat harvest indexes in a plurality of environments, and can be used for carrying out efficient and accurate genotyping identification on the characters. The invention particularly discloses the QTL, a molecular marker therein, a specific primer group for detecting the marker, a kit containing the primer group and application of the kit in wheat molecular marker assisted breeding. The marking identification method is simple, convenient and quick, has stable and reliable results, provides key technical support for synchronously improving the wheat harvest index and grain weight, and has wide breeding application prospect.

Inventors

  • XU SHENGBAO
  • LAI XIANGJUN
  • WANG XIAOMING
  • WANG JUNZHE

Assignees

  • 西北农林科技大学

Dates

Publication Date
20260508
Application Date
20260316

Claims (7)

  1. 1. A molecular marker related to wheat harvest index is characterized in that the molecular marker is located on a wheat 4D chromosome, the nucleotide sequence of the molecular marker is shown as SEQ ID NO.1, wherein G/C base mutation exists at 61 st position of the sequence shown as SEQ ID NO.1, the base of the position is G and is related to a high harvest index phenotype, and the base of the position is C and is related to a low harvest index phenotype.
  2. 2. The molecular marker associated with wheat harvest index according to claim 1, wherein the molecular marker is a KASP marker.
  3. 3. A primer set for amplifying the molecular marker of claim 2, wherein the primer set comprises: Forward primer Ta/u Chr4D_22018842-F1: GAAGGTGACCAAGTTCATGCTTGGCAGAGATGGAAGAGGTC; Forward primer Ta/u Chr4D_22018842-F2: GAAGGTCGGAGTCAACGGATTTGGCAGAGATGGAAGAGGTG; Reverse primer Ta/u chr4d_22018842-R: GTGAGGGCACATCCACTTCT.
  4. 4. The molecular marker primer set according to claim 3, wherein the two forward primers are respectively connected with different fluorescent linker sequences, the 5 'end of the forward primer Ta_Chr4D_22018842-F1 is connected with FAM fluorescent linker sequences, and the 5' end of the forward primer Ta_Chr4D_22018842-F2 is connected with VIC fluorescent linker sequences.
  5. 5. A kit for identifying wheat harvest index comprising the primer set of claim 4.
  6. 6. The use of the molecular marker primer set according to claim 4 or the kit according to claim 5 for identifying a wheat harvest index, wherein the competitive allele-specific PCR amplification is performed by using the primer set or the kit, and the result of the competitive allele-specific PCR amplification is analyzed, and if the sample PCR product detects only the FAM fluorescent signal corresponding to the primer Ta_Ch4D_ 22018842-F1 to which the fluorescent linker sequence is attached, the locus is 0/0 genotype, and the sample PCR product is judged to be of a homozygous type with a low harvest index, and if the sample PCR product detects only the VIC fluorescent signal corresponding to the primer Ta_Ch4D_ 22018842-F2 to which the fluorescent linker sequence is attached, the locus is 1/1 genotype, and the homozygous type with a high harvest index phenotype is judged, and if the two FAM fluorescent signals corresponding to the primer Ta_Ch4D_ 22018842-F1 and Ta_Ch4D_ 22018842-F2 to which the fluorescent linker sequence is attached are simultaneously detected, the locus is judged to be of a heterozygous type with a low harvest index.
  7. 7. A method of identifying a wheat harvest index, the method comprising the steps of: (1) Extracting genome DNA of wheat to be detected; (2) Using the genomic DNA extracted in the step (1) as a template, performing competitive allele-specific PCR amplification by using the primer set of the molecular marker described in claim 4 or the kit described in claim 5, and analyzing the result of the competitive allele-specific PCR amplification; (3) Judging according to the result of the step (2), wherein the specific standard is as follows: A competitive allele-specific PCR amplification was performed using the primer sets Ta_Chr4D_22018842-F1, ta_Chr4D_22018842-F2, and Ta_Chr4D_22018842-R, and if the sample PCR product detected only FAM fluorescent signals corresponding to the primers Ta_Chr4D_22018842-F1 to which the fluorescent linker sequences were attached, the locus was 0/0 genotype, and was judged to be a homozygous type with a low harvest index, and if the sample PCR product detected only VIC fluorescent signals corresponding to the primers Ta_Chr4D_22018842-F2 to which the fluorescent linker sequences were attached, the locus was 1/1 genotype, and if two FAM and VIC fluorescent signals corresponding to the primers Ta_Chr4D_22018842-F1, ta_Cr4D_ 22018842-F2 to which the fluorescent linker sequences were attached were detected simultaneously, the locus was 0/1 genotype, and was judged to be a heterozygous type with a low harvest index.

Description

Molecular marker related to wheat harvest index and application thereof Technical Field The invention belongs to the technical field of biology, and particularly relates to a molecular marker related to wheat harvest index and application thereof. Background Wheat (Triticum aestivum l.) is one of the most important ration crops worldwide, playing an irreplaceable role in guaranteeing grain safety and maintaining social stability. The wheat yield is directly related to the national ration self-supporting rate and the global grain market stability, and the harvest index (namely the ratio of the grain yield to the total biomass of the overground part) is a key index for measuring the conversion efficiency of photosynthetic products to the economic yield, and the improvement of the wheat yield is a core genetic foundation for realizing the yield leap of modern semi-dwarf varieties. Among the yield components, thousand kernel weight is a direct factor that determines kernel pool capacity and fullness, and its stability is critical to final yield. However, wheat harvest index is a typical complex quantitative trait, is controlled by multiple genes and is susceptible to significant environmental conditions, and has complex genetic rules. The traditional breeding method relies on field phenotype data to carry out indirect selection, so that the method has the advantages of long period, high cost and low efficiency, and is difficult to effectively polymerize the micro-effective genes. In order to cope with the challenge, modern molecular breeding methods are widely introduced, and a new idea is provided for the accurate improvement of the wheat harvest index. Molecular marker technology provides a powerful tool for quantitative trait research and application. Among the many label types, the KASP technique is widely used because of its sensitivity, stability, and low cost. KASP relies on allele-specific amplification and fluorescent signal determination to achieve accurate typing of target single nucleotide polymorphisms, and is particularly suitable for rapid screening of large-scale populations. Meanwhile, whole genome association analysis (GWAS) has a key meaning in resolving the wheat harvest index genetic mechanism. By integrating a high density genotype comprising 406 natural population materials with multiple environmental phenotype data, we successfully identified a candidate linkage segment that was significantly correlated with the harvest index. Further multi-effect analysis reveals that the linkage segment also shows a certain synergistic effect on thousand kernel weight while mainly regulating and controlling the harvest index. Molecular markers developed for this segment can be used for selection of high harvest index. In summary, the development of functional KASP markers based on harvest index-related GWAS sites enables early, precise selection of this complex trait at the genotype level. The method is not only helpful for accelerating the cultivation of new varieties of high-yield wheat, but also provides an efficient and feasible breeding strategy for synergistically improving a plurality of yield elements by utilizing the genetic association among traits. Disclosure of Invention A first object of the present invention is to provide a Quantitative Trait Locus (QTL) and molecular markers thereof located on the 4D chromosome of wheat for controlling harvest index and thousand kernel weight. The second object of the invention is to provide the application of the molecular marker in breeding wheat varieties with high harvest index. In order to achieve the above purpose, the invention adopts the following technical scheme: The invention discloses a linkage section related to a wheat high harvest index, which utilizes 11 environments (2019-2023 is being broadcast and late broadcast in Shaanxi Yang Ling and 2018 is being broadcast in Sichuan Chongzhou) containing 406 wheat natural population materials to survey, and calculates the wheat Harvest Index (HI) = (PTN multiplied by KNSTKW/1000)/(PH multiplied by TTN) through a formula, wherein through whole genome association analysis, the linkage section contains 2 SNP loci with obvious association of harvest indexes, namely Ta_Chr4D_22018842: TGGTGGATAATATTTATAAGATTACTGAATTTGAGACGTGGTGGCAGAGATGGAAGAGGT[C/G]AGGAAGAACAAGAAGTGGATGTGCCCTCACTGCGTTGAGGAGACGGGTACCAAGAAATTC.（SEQ ID NO.1 As shown, the SNP site Chr4D_22018842 (C/G) is shown in bold and medium brackets. Wherein there is a C/G base mutation at position 61. Ta_Chr4D_21035056: TTGAGCATCGCGCACGACCGGCTGCACGGCGGCGGCGGCAGCTTGGCCGCGCACGCGGAG[C/A]CCCCAGCGAGCAGGAGGAGCACGACCAAGACCGAAACCCTAGCAAGACATAACTGAAGGG.（SEQ ID NO.2 As shown, the SNP site Chr4D_21035056 (C/A)) is shown in bold and medium brackets. Wherein there is a C/A base mutation at position 61. The candidate segment mainly comprises two haplotypes, as shown in SEQ ID NO.1, when Ta_Ch4D_ 22018842 shows C base (CC genotype, hereinafter also referred to as 0