Search

CN-121992143-A - Molecular marker BnZn-4C4 closely linked with rape zinc content character and application thereof

CN121992143ACN 121992143 ACN121992143 ACN 121992143ACN-121992143-A

Abstract

The invention belongs to the technical fields of molecular biology and genetic breeding, and discloses a molecular marker BnZn-4C4 closely linked with rape zinc content traits and application thereof. The invention obtains a SNP molecular marker which is obviously related to the zinc content of rape, is positioned at 48122046 th base position on C04 chromosome of ZS11 genome, and can explain 10.89% of phenotype variation. The molecular marker is used for auxiliary selection, so that the screening efficiency of rape single plants with high zinc content can be improved.

Inventors

  • WANG HANZHONG
  • DUN XIAOLING
  • SHI JINHUA
  • WANG XINFA
  • ZHANG QIAN
  • WANG NIAN

Assignees

  • 中国农业科学院油料作物研究所

Dates

Publication Date
20260508
Application Date
20260322

Claims (7)

  1. 1. The application of the reagent for detecting the 48122046 th base of the C04 chromosome of the brassica napus in the screening breeding of the zinc content of the brassica napus is judged in a mode that if the 48122046 th base of the C04 chromosome of the brassica napus is detected to be TT genotype, the zinc content of the brassica napus is indicated to be low, and if the 48122046 th base of the C04 chromosome of the brassica napus is detected to be CC genotype, the zinc content of the brassica napus is indicated to be high, and the reference genome of the brassica napus is ZS11.v0.
  2. 2. The application of the reagent for detecting the 48122046 th base of the C04 chromosome of the brassica napus in preparing a brassica napus zinc content screening kit is characterized in that if the 48122046 th base of the C04 chromosome of the brassica napus is detected as a TT genotype, the zinc content of the brassica napus is low, and if the 48122046 th base of the C04 chromosome of the brassica napus is detected as a CC genotype, the zinc content of the brassica napus is high, and the reference genome of the brassica napus is ZS11.v0.
  3. 3. The use according to claim 1 or 2, wherein the agent is a primer.
  4. 4. The use according to claim 3, wherein the primer is a KASP detection primer.
  5. 5. The method according to claim 4, wherein the primers are BnZn-4C4-Ra GTGATCCTTCATACGTAATCCATCA, BNZN-4C4-Rg TGATCCTTCATACGTAATCCATCG and BnZn-4C4-F ATCCTTTGATTGATTTGTGCTCC.
  6. 6. A method for screening and breeding the zinc content of cabbage type rape includes such steps AS detecting the 48122046 th basic group of C04 chromosome of ZS11 genome of cabbage type rape, sequencing, taqMan probe method, AS-PCR method, molecular beacon method, high-resolution dissolving curve method, CAPS method, SNaPshot method, KASP method, PARMS method, gene chip method or mass spectrum method, and judging that if the 48122046 th basic group of C04 chromosome of cabbage type rape is TT genotype, it shows that the zinc content of cabbage type rape is low, and if the 48122046 th basic group of C04 chromosome of cabbage type rape is CC genotype, it shows that the zinc content of cabbage type rape is high, and the reference genome of cabbage type rape is ZS11.v0.
  7. 7. The method according to claim 6, wherein the method is KASP method, and the primers used are BnZn-4C4-Ra GTGATCCTTCATACGTAATCCATCA, BNZN-4C4-Rg TGATCCTTCATACGTAATCCATCG and BnZn-4C4-F ATCCTTTGATTGATTTGTGCTCC.

Description

Molecular marker BnZn-4C4 closely linked with rape zinc content character and application thereof Technical Field The invention belongs to the technical fields of molecular biology and genetic breeding, and particularly relates to a molecular marker BnZn-4C4 closely linked with rape zinc content traits and application thereof. Background Zinc is one of trace elements essential for human body, and plays important physiological and biochemical roles in resisting cancer, promoting growth and reproduction development, improving visual function, participating in catalytic enzyme activity, transmitting signals and the like. Zinc deficiency causes a series of problems such as growth retardation, low immunity and the like of human bodies. Zinc cannot be synthesized directly in the human body and therefore needs to be supplemented by exogenous ingestion. As vegetables, the rape can provide abundant vitamins, cellulose and minerals for human bodies, especially has stronger zinc enrichment capacity, and is a high-quality carrier for zinc nutrition enrichment breeding. The screening or creating of the zinc-rich rape seeds has important significance for improving economic benefit of rape and relieving invisible hunger of human zinc. The traditional breeding relies on phenotype identification, and has the defects of long period, low efficiency, complex detection process and the like. The molecular marker assisted breeding technology can obviously shorten the breeding period and improve the selection efficiency through genotype assisted target character screening. However, the currently reported rape zinc content related molecular markers are few, and the high-efficiency breeding requirement is difficult to meet. The invention uses rape core germplasm resource group as material, utilizes whole genome association analysis (GWAS) to excavate SNP locus related to zinc content and develop closely linked molecular markers, and has important significance for breaking through traditional breeding bottleneck and accelerating the breeding of new variety of zinc-rich rape. Disclosure of Invention The invention aims to provide an application of a reagent for detecting 48122046 th basic group of a C04 chromosome of brassica napus in brassica napus zinc content screening breeding. The invention also aims at providing the application of the reagent for detecting 48122046 th basic group of the C04 chromosome of the brassica napus in preparing a brassica napus zinc content screening kit. The final object of the invention is to provide a method for screening and breeding the zinc content of the brassica napus. In order to achieve the above object, the present invention adopts the following technical measures: Obtaining SNP locus BnZn-C04 closely linked with cabbage type rape zinc content character: (1) The applicant is on a team to collect 347 cabbage type rape germplasm widely, complete continuous selfing for many years, build related groups and complete resequencing, and the average sequencing depth is 25×. And comparing the resequencing data to a reference genome ZS11, and completing SNP identification of the associated population by using software such as GATK4 and the like, wherein the SNP loci comprise 700 ten thousand SNP loci in total. (2) 347 Parts of materials are planted in a male patrol test base of oil crop institute of China academy of agricultural science, 5 overground parts with consistent growth vigor are taken from each material after rape grows to a seventh leaf stage, the overground parts are frozen and dried, the overground parts are uniformly crushed, crushed samples are weighed to be 2.0g, and the zinc content in the samples is measured by using a flame atomic absorption method through the steps of digestion, volume fixing, filtering and the like. (3) The zinc content GWAS was developed using rMVP software, and the threshold was chosen as-log 10 (1/SNP site number) using the MLM model. SNP markers Bn-C04_48122046, which are significantly associated with the zinc content of rape, are detected on the C04 chromosome, and a phenotype variation of 10.89% can be explained at the highest, wherein the SNP variation site (variation from T to C) is positioned at the 48122046 th base of the C04 chromosome of the ZS11 genome of the cabbage type rape, and the zinc content trait site closely linked with the SNP site is named BnZn-C04. (4) Extracting 100bp sequences of upstream and downstream of 48122046 th basic groups of brassica napus C04 chromosome, and developing KASP molecular marker BnZn-4C4 primer BnZn-4C4-Ra GTGATCCTTCATACGTAATCCATCA, BNZN-4C4-Rg TGATCCTTCATACGTAATCCATCG and BnZn-4C4-F ATCCTTTGATTGATTTGTGCTCC according to KASP. The protection scope of the invention comprises: The application of the reagent for detecting 48122046 th base of the C04 chromosome of the brassica napus in the screening breeding of the zinc content of the brassica napus. Application of a reagent for detecting 48122046 th basic group of a C04 chr